EMAIL THIS PAGE TO A FRIEND

C21orf88

chromosome 21 open reading frame 88

Species: Human C21orf88(114041)
UniProtKB ID: P59052, Q0VDC1, Q547X5
Gene ID:
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153754 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141151 MISSION® esiRNA esiRNA human C21orf88 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153754 Rosetta Predictions human pricing
XR_040123 Rosetta Predictions human pricing
XR_040124 Rosetta Predictions human pricing
XR_040125 Rosetta Predictions human pricing
XR_040126 Rosetta Predictions human pricing
XR_040127 Rosetta Predictions human pricing
XR_040128 Rosetta Predictions human pricing
XR_040129 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055872 predicted 197
2 SASI_Hs01_00055873 predicted 198
3 SASI_Hs01_00055874 predicted 176
4 SASI_Hs01_00055875 predicted 192
5 SASI_Hs01_00055876 predicted 177
6 SASI_Hs01_00055877 predicted 202
7 SASI_Hs01_00055878 predicted 197
8 SASI_Hs01_00055879 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040123 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516089 predicted 283
2 SASI_Hs02_00516090 predicted 239
3 SASI_Hs02_00516091 predicted 136
4 SASI_Hs02_00516092 predicted 123
5 SASI_Hs02_00516093 predicted 140
6 SASI_Hs02_00516094 predicted 286
7 SASI_Hs02_00516095 predicted 53
8 SASI_Hs02_00516096 predicted 48
9 SASI_Hs02_00516097 predicted 80
10 SASI_Hs02_00516098 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516099 predicted 305
2 SASI_Hs02_00516100 predicted 342
3 SASI_Hs02_00516101 predicted 156
4 SASI_Hs02_00516102 predicted 579
5 SASI_Hs02_00516103 predicted 109
6 SASI_Hs02_00516104 predicted 191
7 SASI_Hs02_00516105 predicted 132
8 SASI_Hs02_00516106 predicted 160
9 SASI_Hs02_00516107 predicted 134
10 SASI_Hs02_00516108 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516109 predicted 821
2 SASI_Hs02_00516110 predicted 822
3 SASI_Hs02_00516111 predicted 762
4 SASI_Hs02_00516112 predicted 826
5 SASI_Hs02_00516113 predicted 828
6 SASI_Hs02_00516114 predicted 826
7 SASI_Hs02_00516115 predicted 761
8 SASI_Hs02_00516116 predicted 806
9 SASI_Hs02_00516117 predicted 751
10 SASI_Hs02_00516118 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516119 predicted 577
2 SASI_Hs02_00516120 predicted 346
3 SASI_Hs02_00516121 predicted 123
4 SASI_Hs02_00516122 predicted 111
5 SASI_Hs02_00516123 predicted 578
6 SASI_Hs02_00516124 predicted 677
7 SASI_Hs02_00516125 predicted 65
8 SASI_Hs02_00516126 predicted 577
9 SASI_Hs02_00516127 predicted 56
10 SASI_Hs02_00516128 predicted 118
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516129 predicted 826
2 SASI_Hs02_00516130 predicted 825
3 SASI_Hs02_00516131 predicted 765
4 SASI_Hs02_00516132 predicted 832
5 SASI_Hs02_00516133 predicted 829
6 SASI_Hs02_00516134 predicted 820
7 SASI_Hs02_00516135 predicted 762
8 SASI_Hs02_00516136 predicted 814
9 SASI_Hs02_00516137 predicted 758
10 SASI_Hs02_00516138 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516139 predicted 580
2 SASI_Hs02_00516140 predicted 345
3 SASI_Hs02_00516141 predicted 127
4 SASI_Hs02_00516142 predicted 111
5 SASI_Hs02_00516143 predicted 574
6 SASI_Hs02_00516144 predicted 670
7 SASI_Hs02_00516145 predicted 64
8 SASI_Hs02_00516146 predicted 579
9 SASI_Hs02_00516147 predicted 57
10 SASI_Hs02_00516148 predicted 122
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516149 predicted 308
2 SASI_Hs02_00516150 predicted 346
3 SASI_Hs02_00516151 predicted 160
4 SASI_Hs02_00516152 predicted 575
5 SASI_Hs02_00516153 predicted 105
6 SASI_Hs02_00516154 predicted 188
7 SASI_Hs02_00516155 predicted 134
8 SASI_Hs02_00516156 predicted 162
9 SASI_Hs02_00516157 predicted 136
10 SASI_Hs02_00516158 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153754
C21orf88 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 88
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000167167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153754.1-559s1c1
Sequence:CCGGCTTTCATCTTTAAGAGTGCATCTCGAGATGCACTCTTAAAGATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153754.1-383s1c1
Sequence:CCGGGAAGTCCTTGTTTCCTTGCTGCTCGAGCAGCAAGGAAACAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153754.1-521s1c1
Sequence:CCGGCCCGTCTCTTCCATTCTCTATCTCGAGATAGAGAATGGAAGAGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153754
C21orf88 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 88
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000167167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153754.1-559s1c1
Sequence:CCGGCTTTCATCTTTAAGAGTGCATCTCGAGATGCACTCTTAAAGATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153754.1-383s1c1
Sequence:CCGGGAAGTCCTTGTTTCCTTGCTGCTCGAGCAGCAAGGAAACAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153754.1-521s1c1
Sequence:CCGGCCCGTCTCTTCCATTCTCTATCTCGAGATAGAGAATGGAAGAGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153754
C21orf88 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 88
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000167167    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153754.1-559s1c1
Sequence:CCGGCTTTCATCTTTAAGAGTGCATCTCGAGATGCACTCTTAAAGATGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153754.1-383s1c1
Sequence:CCGGGAAGTCCTTGTTTCCTTGCTGCTCGAGCAGCAAGGAAACAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172415    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153754.1-521s1c1
Sequence:CCGGCCCGTCTCTTCCATTCTCTATCTCGAGATAGAGAATGGAAGAGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks