EMAIL THIS PAGE TO A FRIEND

C21orf91

chromosome 21 open reading frame 91

174 Gene Product Result for
Synonyms: C21orf14 C21orf38 CSSG1 EURL YG81
Species: Human C21orf91(54149)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017447 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143941 MISSION® esiRNA esiRNA human C21orf91 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100420 Rosetta Predictions human pricing
NM_001100421 Rosetta Predictions human pricing
NM_017447 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322034 predicted 303
2 SASI_Hs02_00322035 predicted 368
3 SASI_Hs02_00322036 predicted 485
4 SASI_Hs02_00322037 predicted 1144
5 SASI_Hs02_00322038 predicted 231
6 SASI_Hs02_00322039 predicted 255
7 SASI_Hs02_00322040 predicted 1146
8 SASI_Hs02_00322041 predicted 325
9 SASI_Hs02_00322042 predicted 297
10 SASI_Hs02_00322043 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322044 predicted 307
2 SASI_Hs02_00322045 predicted 374
3 SASI_Hs02_00322046 predicted 484
4 SASI_Hs02_00322047 predicted 1080
5 SASI_Hs02_00322048 predicted 230
6 SASI_Hs02_00322049 predicted 261
7 SASI_Hs02_00322050 predicted 1087
8 SASI_Hs02_00322051 predicted 326
9 SASI_Hs02_00322052 predicted 301
10 SASI_Hs02_00322053 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350053 predicted 307
2 SASI_Hs01_00200446 predicted 369
3 SASI_Hs02_00350054 predicted 485
4 SASI_Hs02_00350055 predicted 1139
5 SASI_Hs02_00350056 predicted 229
6 SASI_Hs02_00350057 predicted 255
7 SASI_Hs02_00350058 predicted 1148
8 SASI_Hs01_00200449 predicted 324
9 SASI_Hs02_00350059 predicted 305
10 SASI_Hs02_00350060 predicted 436
11 SASI_Hs01_00200443 predicted 474
12 SASI_Hs01_00200444 predicted 653
13 SASI_Hs01_00200445 predicted 505
14 SASI_Hs01_00200447 predicted 824
15 SASI_Hs01_00200448 predicted 893
16 SASI_Hs01_00200450 predicted 887
17 SASI_Hs01_00200451 predicted 837
18 SASI_Hs01_00200452 predicted 560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017447
VALIDATED
C21orf91 MISSION shRNA Bacterial Glycerol Stock
chromosome 21 open reading frame 91
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017447.2-716s1c1
Sequence:CCGGCTCCTACAGCAAATCCAGGTTCTCGAGAACCTGGATTTGCTGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017447.2-465s1c1
Sequence:CCGGGCATCTCTAACTGTACACAAACTCGAGTTTGTGTACAGTTAGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017447.2-969s1c1
Sequence:CCGGGAAGAAAGTTGTGGTCCGTTTCTCGAGAAACGGACCACAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017447.2-1062s1c1
Sequence:CCGGCTCTAGTCTTCTAGGGCTAATCTCGAGATTAGCCCTAGAAGACTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017447.2-650s1c1
Sequence:CCGGCCACATTACAGCAGAGAGGAACTCGAGTTCCTCTCTGCTGTAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017447.2-286s1c1
Sequence:CCGGGATAAACTGGATTGTGCAGTACTCGAGTACTGCACAATCCAGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017447.3-1053s21c1
Sequence:CCGGGAAGAAAGTTGTGGTCCGTTTCTCGAGAAACGGACCACAACTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017447.3-236s21c1
Sequence:CCGGCTCTTGCACACCAAATCATTACTCGAGTAATGATTTGGTGTGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017447.3-1146s21c1
Sequence:CCGGCTCTAGTCTTCTAGGGCTAATCTCGAGATTAGCCCTAGAAGACTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017447.3-955s21c1
Sequence:CCGGGAAGTCGCACCTACCCATAAACTCGAGTTTATGGGTAGGTGCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017447.3-617s21c1
Sequence:CCGGCAAGATTCAGGTGCCACTTTACTCGAGTAAAGTGGCACCTGAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017447
VALIDATED
C21orf91 MISSION shRNA shRNA Plasmid DNA
chromosome 21 open reading frame 91
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017447.2-716s1c1
Sequence:CCGGCTCCTACAGCAAATCCAGGTTCTCGAGAACCTGGATTTGCTGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017447.2-465s1c1
Sequence:CCGGGCATCTCTAACTGTACACAAACTCGAGTTTGTGTACAGTTAGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017447.2-969s1c1
Sequence:CCGGGAAGAAAGTTGTGGTCCGTTTCTCGAGAAACGGACCACAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017447.2-1062s1c1
Sequence:CCGGCTCTAGTCTTCTAGGGCTAATCTCGAGATTAGCCCTAGAAGACTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017447.2-650s1c1
Sequence:CCGGCCACATTACAGCAGAGAGGAACTCGAGTTCCTCTCTGCTGTAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017447.2-286s1c1
Sequence:CCGGGATAAACTGGATTGTGCAGTACTCGAGTACTGCACAATCCAGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017447.3-1053s21c1
Sequence:CCGGGAAGAAAGTTGTGGTCCGTTTCTCGAGAAACGGACCACAACTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017447.3-236s21c1
Sequence:CCGGCTCTTGCACACCAAATCATTACTCGAGTAATGATTTGGTGTGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017447.3-1146s21c1
Sequence:CCGGCTCTAGTCTTCTAGGGCTAATCTCGAGATTAGCCCTAGAAGACTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017447.3-955s21c1
Sequence:CCGGGAAGTCGCACCTACCCATAAACTCGAGTTTATGGGTAGGTGCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017447.3-617s21c1
Sequence:CCGGCAAGATTCAGGTGCCACTTTACTCGAGTAAAGTGGCACCTGAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017447
VALIDATED
C21orf91 MISSION shRNA Lentiviral Transduction Particles
chromosome 21 open reading frame 91
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017447.2-716s1c1
Sequence:CCGGCTCCTACAGCAAATCCAGGTTCTCGAGAACCTGGATTTGCTGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017447.2-465s1c1
Sequence:CCGGGCATCTCTAACTGTACACAAACTCGAGTTTGTGTACAGTTAGAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017447.2-969s1c1
Sequence:CCGGGAAGAAAGTTGTGGTCCGTTTCTCGAGAAACGGACCACAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017447.2-1062s1c1
Sequence:CCGGCTCTAGTCTTCTAGGGCTAATCTCGAGATTAGCCCTAGAAGACTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017447.2-650s1c1
Sequence:CCGGCCACATTACAGCAGAGAGGAACTCGAGTTCCTCTCTGCTGTAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017447.2-286s1c1
Sequence:CCGGGATAAACTGGATTGTGCAGTACTCGAGTACTGCACAATCCAGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017447.3-1053s21c1
Sequence:CCGGGAAGAAAGTTGTGGTCCGTTTCTCGAGAAACGGACCACAACTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017447.3-236s21c1
Sequence:CCGGCTCTTGCACACCAAATCATTACTCGAGTAATGATTTGGTGTGCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017447.3-1146s21c1
Sequence:CCGGCTCTAGTCTTCTAGGGCTAATCTCGAGATTAGCCCTAGAAGACTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017447.3-955s21c1
Sequence:CCGGGAAGTCGCACCTACCCATAAACTCGAGTTTATGGGTAGGTGCGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017447.3-617s21c1
Sequence:CCGGCAAGATTCAGGTGCCACTTTACTCGAGTAAAGTGGCACCTGAATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks