EMAIL THIS PAGE TO A FRIEND

C22orf15

chromosome 22 open reading frame 15

23 Gene Product Result for
Synonyms: N27C7-3
Species: Human C22orf15(150248)
UniProtKB ID: Q8WYQ4, Q6ICJ7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182520 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098641 MISSION® esiRNA esiRNA human C22orf15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182520 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054982 predicted 802
2 SASI_Hs01_00054983 predicted 755
3 SASI_Hs01_00054984 predicted 816
4 SASI_Hs01_00054985 predicted 1566
5 SASI_Hs01_00054987 predicted 1415
6 SASI_Hs01_00054988 predicted 1521
7 SASI_Hs02_00370607 predicted 1516
8 SASI_Hs01_00054989 predicted 1108
9 SASI_Hs02_00370608 predicted 1222
10 SASI_Hs02_00370609 predicted 1197
11 SASI_Hs01_00054986 predicted 714
12 SASI_Hs01_00054990 predicted 1195
13 SASI_Hs01_00054991 predicted 1477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182520
C22orf15 MISSION shRNA Bacterial Glycerol Stock
chromosome 22 open reading frame 15
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-417s21c1
Sequence:CCGGCTGAGGATGGCAACCTAGTGACTCGAGTCACTAGGTTGCCATCCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-650s21c1
Sequence:CCGGCACAACTGGAGGAAGCGTATGCTCGAGCATACGCTTCCTCCAGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-394s21c1
Sequence:CCGGAGATGCGACCATTGCTCTCCTCTCGAGAGGAGAGCAATGGTCGCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-583s21c1
Sequence:CCGGCCTGGATGACCATTACCCAGACTCGAGTCTGGGTAATGGTCATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-528s21c1
Sequence:CCGGGGATCATCAAGGGAGAGGACACTCGAGTGTCCTCTCCCTTGATGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-324s21c1
Sequence:CCGGTGCTGGTGAACACCTCTTGCACTCGAGTGCAAGAGGTGTTCACCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182520.1-817s1c1
Sequence:CCGGCCACCCGCTATGAGTCCCTATCTCGAGATAGGGACTCATAGCGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122429    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182520.1-870s1c1
Sequence:CCGGGCAGGTGAGTGTCAGGGTACACTCGAGTGTACCCTGACACTCACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182520.1-1359s1c1
Sequence:CCGGCTGCTGGATGAACTCAATGAACTCGAGTTCATTGAGTTCATCCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196128    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182520.1-823s1c2
Sequence:CCGGGCTATGAGTCCCTATTGGAGACTCGAGTCTCCAATAGGGACTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182520
C22orf15 MISSION shRNA shRNA Plasmid DNA
chromosome 22 open reading frame 15
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-417s21c1
Sequence:CCGGCTGAGGATGGCAACCTAGTGACTCGAGTCACTAGGTTGCCATCCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-650s21c1
Sequence:CCGGCACAACTGGAGGAAGCGTATGCTCGAGCATACGCTTCCTCCAGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-394s21c1
Sequence:CCGGAGATGCGACCATTGCTCTCCTCTCGAGAGGAGAGCAATGGTCGCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-583s21c1
Sequence:CCGGCCTGGATGACCATTACCCAGACTCGAGTCTGGGTAATGGTCATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-528s21c1
Sequence:CCGGGGATCATCAAGGGAGAGGACACTCGAGTGTCCTCTCCCTTGATGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-324s21c1
Sequence:CCGGTGCTGGTGAACACCTCTTGCACTCGAGTGCAAGAGGTGTTCACCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182520.1-817s1c1
Sequence:CCGGCCACCCGCTATGAGTCCCTATCTCGAGATAGGGACTCATAGCGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122429    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182520.1-870s1c1
Sequence:CCGGGCAGGTGAGTGTCAGGGTACACTCGAGTGTACCCTGACACTCACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182520.1-1359s1c1
Sequence:CCGGCTGCTGGATGAACTCAATGAACTCGAGTTCATTGAGTTCATCCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196128    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182520.1-823s1c2
Sequence:CCGGGCTATGAGTCCCTATTGGAGACTCGAGTCTCCAATAGGGACTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182520
C22orf15 MISSION shRNA Lentiviral Transduction Particles
chromosome 22 open reading frame 15
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-417s21c1
Sequence:CCGGCTGAGGATGGCAACCTAGTGACTCGAGTCACTAGGTTGCCATCCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-650s21c1
Sequence:CCGGCACAACTGGAGGAAGCGTATGCTCGAGCATACGCTTCCTCCAGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-394s21c1
Sequence:CCGGAGATGCGACCATTGCTCTCCTCTCGAGAGGAGAGCAATGGTCGCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-583s21c1
Sequence:CCGGCCTGGATGACCATTACCCAGACTCGAGTCTGGGTAATGGTCATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-528s21c1
Sequence:CCGGGGATCATCAAGGGAGAGGACACTCGAGTGTCCTCTCCCTTGATGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182520.2-324s21c1
Sequence:CCGGTGCTGGTGAACACCTCTTGCACTCGAGTGCAAGAGGTGTTCACCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122595    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182520.1-817s1c1
Sequence:CCGGCCACCCGCTATGAGTCCCTATCTCGAGATAGGGACTCATAGCGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122429    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182520.1-870s1c1
Sequence:CCGGGCAGGTGAGTGTCAGGGTACACTCGAGTGTACCCTGACACTCACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182520.1-1359s1c1
Sequence:CCGGCTGCTGGATGAACTCAATGAACTCGAGTTCATTGAGTTCATCCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196128    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182520.1-823s1c2
Sequence:CCGGGCTATGAGTCCCTATTGGAGACTCGAGTCTCCAATAGGGACTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)