EMAIL THIS PAGE TO A FRIEND

C22orf23

chromosome 22 open reading frame 23

18 Gene Product Result for
Synonyms: EVG1 dJ1039K5.6
Species: Human C22orf23(84645)
UniProtKB ID: Q9BZE7, Q5JYU9, Q96M68
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032561 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053051 MISSION® esiRNA esiRNA human C22orf23 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032561 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072580 predicted 1146
2 SASI_Hs01_00072581 predicted 858
3 SASI_Hs01_00072582 predicted 809
4 SASI_Hs02_00360077 predicted 493
5 SASI_Hs01_00072584 predicted 797
6 SASI_Hs01_00072585 predicted 1155
7 SASI_Hs01_00072586 predicted 899
8 SASI_Hs01_00072587 predicted 808
9 SASI_Hs01_00072588 predicted 465
10 SASI_Hs01_00072589 predicted 900
11 SASI_Hs01_00072583 predicted 839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032561
C22orf23 MISSION shRNA Bacterial Glycerol Stock
chromosome 22 open reading frame 23
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-823s1c1
Sequence:CCGGCCTTGCTGAAATCTCCCAGAACTCGAGTTCTGGGAGATTTCAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-812s1c1
Sequence:CCGGCGAGGAATCATCCTTGCTGAACTCGAGTTCAGCAAGGATGATTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-466s1c1
Sequence:CCGGCCAGAGAGTCTTACCTTCCAACTCGAGTTGGAAGGTAAGACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-881s1c1
Sequence:CCGGGAGGAACTTAGGAAGGGTCTTCTCGAGAAGACCCTTCCTAAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-370s1c1
Sequence:CCGGGAAGGAATCCAAACTGACGAACTCGAGTTCGTCAGTTTGGATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032561.2-1342s21c1
Sequence:CCGGCATATTTAACGTGGGTCATTACTCGAGTAATGACCCACGTTAAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032561.2-1319s21c1
Sequence:CCGGCAATGATTAACTGGCCAATAACTCGAGTTATTGGCCAGTTAATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032561.2-716s21c1
Sequence:CCGGCCTGAGCTAGACCGATTTGAACTCGAGTTCAAATCGGTCTAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032561
C22orf23 MISSION shRNA shRNA Plasmid DNA
chromosome 22 open reading frame 23
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-823s1c1
Sequence:CCGGCCTTGCTGAAATCTCCCAGAACTCGAGTTCTGGGAGATTTCAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-812s1c1
Sequence:CCGGCGAGGAATCATCCTTGCTGAACTCGAGTTCAGCAAGGATGATTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-466s1c1
Sequence:CCGGCCAGAGAGTCTTACCTTCCAACTCGAGTTGGAAGGTAAGACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-881s1c1
Sequence:CCGGGAGGAACTTAGGAAGGGTCTTCTCGAGAAGACCCTTCCTAAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-370s1c1
Sequence:CCGGGAAGGAATCCAAACTGACGAACTCGAGTTCGTCAGTTTGGATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032561.2-1342s21c1
Sequence:CCGGCATATTTAACGTGGGTCATTACTCGAGTAATGACCCACGTTAAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032561.2-1319s21c1
Sequence:CCGGCAATGATTAACTGGCCAATAACTCGAGTTATTGGCCAGTTAATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032561.2-716s21c1
Sequence:CCGGCCTGAGCTAGACCGATTTGAACTCGAGTTCAAATCGGTCTAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032561
C22orf23 MISSION shRNA Lentiviral Transduction Particles
chromosome 22 open reading frame 23
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-823s1c1
Sequence:CCGGCCTTGCTGAAATCTCCCAGAACTCGAGTTCTGGGAGATTTCAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-812s1c1
Sequence:CCGGCGAGGAATCATCCTTGCTGAACTCGAGTTCAGCAAGGATGATTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-466s1c1
Sequence:CCGGCCAGAGAGTCTTACCTTCCAACTCGAGTTGGAAGGTAAGACTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-881s1c1
Sequence:CCGGGAGGAACTTAGGAAGGGTCTTCTCGAGAAGACCCTTCCTAAGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032561.2-370s1c1
Sequence:CCGGGAAGGAATCCAAACTGACGAACTCGAGTTCGTCAGTTTGGATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032561.2-1342s21c1
Sequence:CCGGCATATTTAACGTGGGTCATTACTCGAGTAATGACCCACGTTAAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032561.2-1319s21c1
Sequence:CCGGCAATGATTAACTGGCCAATAACTCGAGTTATTGGCCAGTTAATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032561.2-716s21c1
Sequence:CCGGCCTGAGCTAGACCGATTTGAACTCGAGTTCAAATCGGTCTAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks