EMAIL THIS PAGE TO A FRIEND

C22orf24

chromosome 22 open reading frame 24

47 Gene Product Result for
Synonyms: HSN44A4A
Species: Human C22orf24(25775)
UniProtKB ID: Q9Y442, B2RCT4, Q5K3R1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301054 ANTI-C22ORF24 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015372 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015372 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015372 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159221 MISSION® esiRNA esiRNA human C22orf24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015372 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347711 predicted 202
2 SASI_Hs02_00347712 predicted 202
3 SASI_Hs02_00347713 predicted 231
4 SASI_Hs02_00347714 predicted 767
5 SASI_Hs02_00347715 predicted 784
6 SASI_Hs02_00347716 predicted 224
7 SASI_Hs02_00347717 predicted 203
8 SASI_Hs02_00347718 predicted 220
9 SASI_Hs02_00347719 predicted 786
10 SASI_Hs02_00347720 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015372
C22orf24 MISSION shRNA Bacterial Glycerol Stock
chromosome 22 open reading frame 24
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015372.1-482s21c1
Sequence:CCGGCGCACTGTGCTTGGCATATAGCTCGAGCTATATGCCAAGCACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015372.1-607s21c1
Sequence:CCGGTTCCTGCCACACCTTACATTACTCGAGTAATGTAAGGTGTGGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015372.1-292s21c1
Sequence:CCGGACTACGCTGTCTCTTGGTTAACTCGAGTTAACCAAGAGACAGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015372.1-509s21c1
Sequence:CCGGCTCAATAAATATCTGCCAAATCTCGAGATTTGGCAGATATTTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015372.1-913s21c1
Sequence:CCGGGAGCATTCTGCCGACCCATTTCTCGAGAAATGGGTCGGCAGAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015372
C22orf24 MISSION shRNA shRNA Plasmid DNA
chromosome 22 open reading frame 24
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015372.1-482s21c1
Sequence:CCGGCGCACTGTGCTTGGCATATAGCTCGAGCTATATGCCAAGCACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015372.1-607s21c1
Sequence:CCGGTTCCTGCCACACCTTACATTACTCGAGTAATGTAAGGTGTGGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015372.1-292s21c1
Sequence:CCGGACTACGCTGTCTCTTGGTTAACTCGAGTTAACCAAGAGACAGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015372.1-509s21c1
Sequence:CCGGCTCAATAAATATCTGCCAAATCTCGAGATTTGGCAGATATTTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015372.1-913s21c1
Sequence:CCGGGAGCATTCTGCCGACCCATTTCTCGAGAAATGGGTCGGCAGAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015372
C22orf24 MISSION shRNA Lentiviral Transduction Particles
chromosome 22 open reading frame 24
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015372.1-482s21c1
Sequence:CCGGCGCACTGTGCTTGGCATATAGCTCGAGCTATATGCCAAGCACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015372.1-607s21c1
Sequence:CCGGTTCCTGCCACACCTTACATTACTCGAGTAATGTAAGGTGTGGCAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015372.1-292s21c1
Sequence:CCGGACTACGCTGTCTCTTGGTTAACTCGAGTTAACCAAGAGACAGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015372.1-509s21c1
Sequence:CCGGCTCAATAAATATCTGCCAAATCTCGAGATTTGGCAGATATTTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015372.1-913s21c1
Sequence:CCGGGAGCATTCTGCCGACCCATTTCTCGAGAAATGGGTCGGCAGAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks