EMAIL THIS PAGE TO A FRIEND

C22orf26

chromosome 22 open reading frame 26

16 Gene Product Result for
Species: Human C22orf26(55267)
UniProtKB ID: Q9NV39, B0QZ24
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302415 ANTI-C22ORF26 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018280 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018280 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147402 predicted 487
2 SASI_Hs01_00147403 predicted 570
3 SASI_Hs01_00147404 predicted 701
4 SASI_Hs01_00147405 predicted 894
5 SASI_Hs01_00147406 predicted 491
6 SASI_Hs02_00351653 predicted 644
7 SASI_Hs01_00147408 predicted 1330
8 SASI_Hs01_00147410 predicted 1315
9 SASI_Hs01_00147411 predicted 1320
10 SASI_Hs02_00351654 predicted 1273
11 SASI_Hs01_00147407 predicted 644
12 SASI_Hs01_00147409 predicted 1230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018280
C22orf26 MISSION shRNA Bacterial Glycerol Stock
chromosome 22 open reading frame 26
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-571s21c1
Sequence:CCGGCAGAGAGGCAGCTAAGTCTTTCTCGAGAAAGACTTAGCTGCCTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-495s21c1
Sequence:CCGGGCTCTTAACCACCCTACTATGCTCGAGCATAGTAGGGTGGTTAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-1320s21c1
Sequence:CCGGACCTTGTAGATGGCCTCTATTCTCGAGAATAGAGGCCATCTACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-781s21c1
Sequence:CCGGAGCTTTACCATCAGCGATGTGCTCGAGCACATCGCTGATGGTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-767s21c1
Sequence:CCGGGAGCCTGTTGCTACAGCTTTACTCGAGTAAAGCTGTAGCAACAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-899s21c1
Sequence:CCGGCTCATGGGACAGACCATTCACCTCGAGGTGAATGGTCTGTCCCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-958s21c1
Sequence:CCGGCAGACTCTTCTCCACGGACAACTCGAGTTGTCCGTGGAGAAGAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018280.1-1315s1c1
Sequence:CCGGGAAGAGGACACTGAAGGCATTCTCGAGAATGCCTTCAGTGTCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018280
C22orf26 MISSION shRNA shRNA Plasmid DNA
chromosome 22 open reading frame 26
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-571s21c1
Sequence:CCGGCAGAGAGGCAGCTAAGTCTTTCTCGAGAAAGACTTAGCTGCCTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-495s21c1
Sequence:CCGGGCTCTTAACCACCCTACTATGCTCGAGCATAGTAGGGTGGTTAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-1320s21c1
Sequence:CCGGACCTTGTAGATGGCCTCTATTCTCGAGAATAGAGGCCATCTACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-781s21c1
Sequence:CCGGAGCTTTACCATCAGCGATGTGCTCGAGCACATCGCTGATGGTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-767s21c1
Sequence:CCGGGAGCCTGTTGCTACAGCTTTACTCGAGTAAAGCTGTAGCAACAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-899s21c1
Sequence:CCGGCTCATGGGACAGACCATTCACCTCGAGGTGAATGGTCTGTCCCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-958s21c1
Sequence:CCGGCAGACTCTTCTCCACGGACAACTCGAGTTGTCCGTGGAGAAGAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018280.1-1315s1c1
Sequence:CCGGGAAGAGGACACTGAAGGCATTCTCGAGAATGCCTTCAGTGTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018280
C22orf26 MISSION shRNA Lentiviral Transduction Particles
chromosome 22 open reading frame 26
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-571s21c1
Sequence:CCGGCAGAGAGGCAGCTAAGTCTTTCTCGAGAAAGACTTAGCTGCCTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268489    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-495s21c1
Sequence:CCGGGCTCTTAACCACCCTACTATGCTCGAGCATAGTAGGGTGGTTAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-1320s21c1
Sequence:CCGGACCTTGTAGATGGCCTCTATTCTCGAGAATAGAGGCCATCTACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-781s21c1
Sequence:CCGGAGCTTTACCATCAGCGATGTGCTCGAGCACATCGCTGATGGTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-767s21c1
Sequence:CCGGGAGCCTGTTGCTACAGCTTTACTCGAGTAAAGCTGTAGCAACAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-899s21c1
Sequence:CCGGCTCATGGGACAGACCATTCACCTCGAGGTGAATGGTCTGTCCCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018280.2-958s21c1
Sequence:CCGGCAGACTCTTCTCCACGGACAACTCGAGTTGTCCGTGGAGAAGAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172685    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018280.1-1315s1c1
Sequence:CCGGGAAGAGGACACTGAAGGCATTCTCGAGAATGCCTTCAGTGTCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)