EMAIL THIS PAGE TO A FRIEND

C22orf29

chromosome 22 open reading frame 29

16 Gene Product Result for
Synonyms: BOP
Species: Human C22orf29(79680)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024627 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024627 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024627 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024627 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213067 predicted 1897
2 SASI_Hs01_00213068 predicted 877
3 SASI_Hs01_00213069 predicted 1242
4 SASI_Hs01_00213070 predicted 805
5 SASI_Hs01_00213071 predicted 679
6 SASI_Hs01_00213072 predicted 884
7 SASI_Hs01_00213073 predicted 930
8 SASI_Hs01_00213074 predicted 545
9 SASI_Hs01_00213075 predicted 712
10 SASI_Hs01_00213076 predicted 996
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024627
C22orf29 MISSION shRNA Bacterial Glycerol Stock
chromosome 22 open reading frame 29
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024627.4-4655s1c1
Sequence:CCGGGCCACAATAGTTAAAGCACTTCTCGAGAAGTGCTTTAACTATTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024627.4-4845s1c1
Sequence:CCGGGCCAGTACATATTCCAGATTACTCGAGTAATCTGGAATATGTACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-1000s1c1
Sequence:CCGGGATCTCAAGGAAGTTGTTCAACTCGAGTTGAACAACTTCCTTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-1119s1c1
Sequence:CCGGGCAATACTTAGCTAGGTTCTTCTCGAGAAGAACCTAGCTAAGTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-1116s1c1
Sequence:CCGGGAGGCAATACTTAGCTAGGTTCTCGAGAACCTAGCTAAGTATTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-1301s1c1
Sequence:CCGGCCAGTTCTACATGTAGCTCCACTCGAGTGGAGCTACATGTAGAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-868s1c1
Sequence:CCGGGAGCACTATCAGGACAACATCCTCGAGGATGTTGTCCTGATAGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-864s1c1
Sequence:CCGGCTTTGAGCACTATCAGGACAACTCGAGTTGTCCTGATAGTGCTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-857s1c1
Sequence:CCGGCCTTCCACTTTGAGCACTATCCTCGAGGATAGTGCTCAAAGTGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-997s1c1
Sequence:CCGGCAGGATCTCAAGGAAGTTGTTCTCGAGAACAACTTCCTTGAGATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024627.4-4507s1c1
Sequence:CCGGCCTTGGAAATACCCAGAGATTCTCGAGAATCTCTGGGTATTTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024627.4-1108s1c1
Sequence:CCGGCCTGTGGTGAGGCAATACTTACTCGAGTAAGTATTGCCTCACCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024627.4-846s1c1
Sequence:CCGGCGATTACATGTCCTTCCACTTCTCGAGAAGTGGAAGGACATGTAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024627
C22orf29 MISSION shRNA shRNA Plasmid DNA
chromosome 22 open reading frame 29
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024627.4-4655s1c1
Sequence:CCGGGCCACAATAGTTAAAGCACTTCTCGAGAAGTGCTTTAACTATTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024627.4-4845s1c1
Sequence:CCGGGCCAGTACATATTCCAGATTACTCGAGTAATCTGGAATATGTACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-1000s1c1
Sequence:CCGGGATCTCAAGGAAGTTGTTCAACTCGAGTTGAACAACTTCCTTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-1119s1c1
Sequence:CCGGGCAATACTTAGCTAGGTTCTTCTCGAGAAGAACCTAGCTAAGTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-1116s1c1
Sequence:CCGGGAGGCAATACTTAGCTAGGTTCTCGAGAACCTAGCTAAGTATTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-1301s1c1
Sequence:CCGGCCAGTTCTACATGTAGCTCCACTCGAGTGGAGCTACATGTAGAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-868s1c1
Sequence:CCGGGAGCACTATCAGGACAACATCCTCGAGGATGTTGTCCTGATAGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-864s1c1
Sequence:CCGGCTTTGAGCACTATCAGGACAACTCGAGTTGTCCTGATAGTGCTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-857s1c1
Sequence:CCGGCCTTCCACTTTGAGCACTATCCTCGAGGATAGTGCTCAAAGTGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-997s1c1
Sequence:CCGGCAGGATCTCAAGGAAGTTGTTCTCGAGAACAACTTCCTTGAGATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024627.4-4507s1c1
Sequence:CCGGCCTTGGAAATACCCAGAGATTCTCGAGAATCTCTGGGTATTTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024627.4-1108s1c1
Sequence:CCGGCCTGTGGTGAGGCAATACTTACTCGAGTAAGTATTGCCTCACCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024627.4-846s1c1
Sequence:CCGGCGATTACATGTCCTTCCACTTCTCGAGAAGTGGAAGGACATGTAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024627
C22orf29 MISSION shRNA Lentiviral Transduction Particles
chromosome 22 open reading frame 29
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145415    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024627.4-4655s1c1
Sequence:CCGGGCCACAATAGTTAAAGCACTTCTCGAGAAGTGCTTTAACTATTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024627.4-4845s1c1
Sequence:CCGGGCCAGTACATATTCCAGATTACTCGAGTAATCTGGAATATGTACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-1000s1c1
Sequence:CCGGGATCTCAAGGAAGTTGTTCAACTCGAGTTGAACAACTTCCTTGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-1119s1c1
Sequence:CCGGGCAATACTTAGCTAGGTTCTTCTCGAGAAGAACCTAGCTAAGTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-1116s1c1
Sequence:CCGGGAGGCAATACTTAGCTAGGTTCTCGAGAACCTAGCTAAGTATTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-1301s1c1
Sequence:CCGGCCAGTTCTACATGTAGCTCCACTCGAGTGGAGCTACATGTAGAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-868s1c1
Sequence:CCGGGAGCACTATCAGGACAACATCCTCGAGGATGTTGTCCTGATAGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142941    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-864s1c1
Sequence:CCGGCTTTGAGCACTATCAGGACAACTCGAGTTGTCCTGATAGTGCTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-857s1c1
Sequence:CCGGCCTTCCACTTTGAGCACTATCCTCGAGGATAGTGCTCAAAGTGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024627.4-997s1c1
Sequence:CCGGCAGGATCTCAAGGAAGTTGTTCTCGAGAACAACTTCCTTGAGATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024627.4-4507s1c1
Sequence:CCGGCCTTGGAAATACCCAGAGATTCTCGAGAATCTCTGGGTATTTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024627.4-1108s1c1
Sequence:CCGGCCTGTGGTGAGGCAATACTTACTCGAGTAAGTATTGCCTCACCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024627.4-846s1c1
Sequence:CCGGCGATTACATGTCCTTCCACTTCTCGAGAAGTGGAAGGACATGTAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)