EMAIL THIS PAGE TO A FRIEND

C22orf31

chromosome 22 open reading frame 31

Synonyms: HS747E2A bK747E2.1
Species: Human C22orf31(25770)
UniProtKB ID: O95567, A0AV97
Gene ID:
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015370 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154731 MISSION® esiRNA esiRNA human C22orf31 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015370 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071723 predicted 338
2 SASI_Hs02_00347709 predicted 686
3 SASI_Hs01_00071724 predicted 324
4 SASI_Hs01_00071725 predicted 788
5 SASI_Hs01_00071726 predicted 446
6 SASI_Hs01_00071728 predicted 708
7 SASI_Hs01_00071730 predicted 348
8 SASI_Hs02_00347710 predicted 328
9 SASI_Hs01_00071731 predicted 486
10 SASI_Hs01_00071732 predicted 680
11 SASI_Hs01_00071727 predicted 305
12 SASI_Hs01_00071729 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015370
C22orf31 MISSION shRNA Bacterial Glycerol Stock
chromosome 22 open reading frame 31
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-448s1c1
Sequence:CCGGCAAGGACGATTCAGTGATGAACTCGAGTTCATCACTGAATCGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-599s1c1
Sequence:CCGGCAAGATCTTGAGGACAGATATCTCGAGATATCTGTCCTCAAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015370.1-598s1c1
Sequence:CCGGCCAAGATCTTGAGGACAGATACTCGAGTATCTGTCCTCAAGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-430s1c1
Sequence:CCGGCTCGAAGAGATTAAAGCACAACTCGAGTTGTGCTTTAATCTCTTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-314s1c1
Sequence:CCGGGAAGTTGTAAGGAACCCATTACTCGAGTAATGGGTTCCTTACAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-174s1c1
Sequence:CCGGGACTCCGACAGTCCATCTTATCTCGAGATAAGATGGACTGTCGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-364s21c1
Sequence:CCGGTGTACTCAGGCGGCAACTGAACTCGAGTTCAGTTGCCGCCTGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-341s21c1
Sequence:CCGGAGTTCCTTCTCCCTGGTTAAGCTCGAGCTTAACCAGGGAGAAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-793s21c1
Sequence:CCGGGCCAATGCTGTGGAATCCTTCCTCGAGGAAGGATTCCACAGCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-546s21c1
Sequence:CCGGGAGGCATCAGAGAGAGTAAAGCTCGAGCTTTACTCTCTCTGATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-717s21c1
Sequence:CCGGAGTTGTCGGAGGACACGCTAACTCGAGTTAGCGTGTCCTCCGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015370
C22orf31 MISSION shRNA shRNA Plasmid DNA
chromosome 22 open reading frame 31
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-448s1c1
Sequence:CCGGCAAGGACGATTCAGTGATGAACTCGAGTTCATCACTGAATCGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-599s1c1
Sequence:CCGGCAAGATCTTGAGGACAGATATCTCGAGATATCTGTCCTCAAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015370.1-598s1c1
Sequence:CCGGCCAAGATCTTGAGGACAGATACTCGAGTATCTGTCCTCAAGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-430s1c1
Sequence:CCGGCTCGAAGAGATTAAAGCACAACTCGAGTTGTGCTTTAATCTCTTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-314s1c1
Sequence:CCGGGAAGTTGTAAGGAACCCATTACTCGAGTAATGGGTTCCTTACAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-174s1c1
Sequence:CCGGGACTCCGACAGTCCATCTTATCTCGAGATAAGATGGACTGTCGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-364s21c1
Sequence:CCGGTGTACTCAGGCGGCAACTGAACTCGAGTTCAGTTGCCGCCTGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-341s21c1
Sequence:CCGGAGTTCCTTCTCCCTGGTTAAGCTCGAGCTTAACCAGGGAGAAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-793s21c1
Sequence:CCGGGCCAATGCTGTGGAATCCTTCCTCGAGGAAGGATTCCACAGCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-546s21c1
Sequence:CCGGGAGGCATCAGAGAGAGTAAAGCTCGAGCTTTACTCTCTCTGATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-717s21c1
Sequence:CCGGAGTTGTCGGAGGACACGCTAACTCGAGTTAGCGTGTCCTCCGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015370
C22orf31 MISSION shRNA Lentiviral Transduction Particles
chromosome 22 open reading frame 31
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-448s1c1
Sequence:CCGGCAAGGACGATTCAGTGATGAACTCGAGTTCATCACTGAATCGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-599s1c1
Sequence:CCGGCAAGATCTTGAGGACAGATATCTCGAGATATCTGTCCTCAAGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015370.1-598s1c1
Sequence:CCGGCCAAGATCTTGAGGACAGATACTCGAGTATCTGTCCTCAAGATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-430s1c1
Sequence:CCGGCTCGAAGAGATTAAAGCACAACTCGAGTTGTGCTTTAATCTCTTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-314s1c1
Sequence:CCGGGAAGTTGTAAGGAACCCATTACTCGAGTAATGGGTTCCTTACAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015370.1-174s1c1
Sequence:CCGGGACTCCGACAGTCCATCTTATCTCGAGATAAGATGGACTGTCGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-364s21c1
Sequence:CCGGTGTACTCAGGCGGCAACTGAACTCGAGTTCAGTTGCCGCCTGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-341s21c1
Sequence:CCGGAGTTCCTTCTCCCTGGTTAAGCTCGAGCTTAACCAGGGAGAAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-793s21c1
Sequence:CCGGGCCAATGCTGTGGAATCCTTCCTCGAGGAAGGATTCCACAGCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-546s21c1
Sequence:CCGGGAGGCATCAGAGAGAGTAAAGCTCGAGCTTTACTCTCTCTGATGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015370.1-717s21c1
Sequence:CCGGAGTTGTCGGAGGACACGCTAACTCGAGTTAGCGTGTCCTCCGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks