EMAIL THIS PAGE TO A FRIEND

C22orf34

chromosome 22 open reading frame 34

40 Gene Product Result for
Species: Human C22orf34(348645)
UniProtKB ID: Q6ZV56, Q147Y0, Q5R3D1, Q6ZTN8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198851 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039473 Rosetta Predictions human pricing
XR_040809 Rosetta Predictions human pricing
XR_040810 Rosetta Predictions human pricing
XR_040811 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065875 predicted 817
2 SASI_Hs01_00065876 predicted 172
3 SASI_Hs01_00065877 predicted 410
4 SASI_Hs01_00065878 predicted 176
5 SASI_Hs01_00065879 predicted 1155
6 SASI_Hs01_00065880 predicted 1277
7 SASI_Hs01_00065881 predicted 1184
8 SASI_Hs01_00065882 predicted 1230
9 SASI_Hs01_00065883 predicted 1183
10 SASI_Hs01_00065884 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522121 predicted 1153
2 SASI_Hs02_00522122 predicted 1179
3 SASI_Hs02_00522123 predicted 171
4 SASI_Hs02_00522124 predicted 402
5 SASI_Hs02_00522125 predicted 1225
6 SASI_Hs02_00522126 predicted 423
7 SASI_Hs02_00522127 predicted 817
8 SASI_Hs02_00522128 predicted 169
9 SASI_Hs02_00522129 predicted 878
10 SASI_Hs02_00522130 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522131 predicted 963
2 SASI_Hs02_00522132 predicted 972
3 SASI_Hs02_00522133 predicted 559
4 SASI_Hs02_00522134 predicted 793
5 SASI_Hs02_00522135 predicted 946
6 SASI_Hs02_00522136 predicted 920
7 SASI_Hs02_00522137 predicted 509
8 SASI_Hs02_00522138 predicted 1049
9 SASI_Hs02_00522139 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522140 predicted 958
2 SASI_Hs02_00522141 predicted 973
3 SASI_Hs02_00522142 predicted 555
4 SASI_Hs02_00522143 predicted 795
5 SASI_Hs02_00522144 predicted 955
6 SASI_Hs02_00522145 predicted 927
7 SASI_Hs02_00522146 predicted 510
8 SASI_Hs02_00522147 predicted 1048
9 SASI_Hs02_00522148 predicted 377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198851
C22orf34 MISSION shRNA Bacterial Glycerol Stock
chromosome 22 open reading frame 34
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149311    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198851.1-2134s1c1
Sequence:CCGGGCCAGACACAGAAAGACAAATCTCGAGATTTGTCTTTCTGTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198851.1-607s1c1
Sequence:CCGGCAATACAGATGTGGCAGGTTTCTCGAGAAACCTGCCACATCTGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198851.1-949s1c1
Sequence:CCGGCGTGACAATGCATTTGATTCACTCGAGTGAATCAAATGCATTGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198851.1-2135s1c1
Sequence:CCGGCCAGACACAGAAAGACAAATACTCGAGTATTTGTCTTTCTGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198851.1-996s1c1
Sequence:CCGGGTCTGTCTTTATCTCACTGTGCTCGAGCACAGTGAGATAAAGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198851.1-984s1c1
Sequence:CCGGCACTGTCTCTATGTCTGTCTTCTCGAGAAGACAGACATAGAGACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198851
C22orf34 MISSION shRNA shRNA Plasmid DNA
chromosome 22 open reading frame 34
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149311    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198851.1-2134s1c1
Sequence:CCGGGCCAGACACAGAAAGACAAATCTCGAGATTTGTCTTTCTGTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198851.1-607s1c1
Sequence:CCGGCAATACAGATGTGGCAGGTTTCTCGAGAAACCTGCCACATCTGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198851.1-949s1c1
Sequence:CCGGCGTGACAATGCATTTGATTCACTCGAGTGAATCAAATGCATTGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198851.1-2135s1c1
Sequence:CCGGCCAGACACAGAAAGACAAATACTCGAGTATTTGTCTTTCTGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198851.1-996s1c1
Sequence:CCGGGTCTGTCTTTATCTCACTGTGCTCGAGCACAGTGAGATAAAGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198851.1-984s1c1
Sequence:CCGGCACTGTCTCTATGTCTGTCTTCTCGAGAAGACAGACATAGAGACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198851
C22orf34 MISSION shRNA Lentiviral Transduction Particles
chromosome 22 open reading frame 34
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149311    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198851.1-2134s1c1
Sequence:CCGGGCCAGACACAGAAAGACAAATCTCGAGATTTGTCTTTCTGTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198851.1-607s1c1
Sequence:CCGGCAATACAGATGTGGCAGGTTTCTCGAGAAACCTGCCACATCTGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198851.1-949s1c1
Sequence:CCGGCGTGACAATGCATTTGATTCACTCGAGTGAATCAAATGCATTGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198851.1-2135s1c1
Sequence:CCGGCCAGACACAGAAAGACAAATACTCGAGTATTTGTCTTTCTGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198851.1-996s1c1
Sequence:CCGGGTCTGTCTTTATCTCACTGTGCTCGAGCACAGTGAGATAAAGACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198851.1-984s1c1
Sequence:CCGGCACTGTCTCTATGTCTGTCTTCTCGAGAAGACAGACATAGAGACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks