EMAIL THIS PAGE TO A FRIEND

C22orf39

chromosome 22 open reading frame 39

19 Gene Product Result for
Species: Human C22orf39(128977)
UniProtKB ID: Q6P5X5, A8MTW6, D3DX18, F5H3A8, J3KNP9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173793 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173793 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212651 predicted 683
2 SASI_Hs01_00212652 predicted 412
3 SASI_Hs01_00212653 predicted 766
4 SASI_Hs01_00212654 predicted 738
5 SASI_Hs01_00212655 predicted 636
6 SASI_Hs01_00212656 predicted 560
7 SASI_Hs01_00212658 predicted 497
8 SASI_Hs01_00212659 predicted 683
9 SASI_Hs02_00368647 predicted 437
10 SASI_Hs01_00212660 predicted 568
11 SASI_Hs01_00212657 predicted 351
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173793
C22orf39 MISSION shRNA Bacterial Glycerol Stock
chromosome 22 open reading frame 39
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166018    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-685s1c1
Sequence:CCGGGACACACAGGTGGGTCATAATCTCGAGATTATGACCCACCTGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-726s1c1
Sequence:CCGGCCACTGTGAATGTCTTTCCTACTCGAGTAGGAAAGACATTCACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159410    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-1075s1c1
Sequence:CCGGGCCATTTCATCTGATTTCAAACTCGAGTTTGAAATCAGATGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162609    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-1053s1c1
Sequence:CCGGCCTGGTGGTTAATGTATCAAACTCGAGTTTGATACATTAACCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-994s1c1
Sequence:CCGGGCTGAAGAAATCCAAGTCCAACTCGAGTTGGACTTGGATTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-1052s1c1
Sequence:CCGGCCCTGGTGGTTAATGTATCAACTCGAGTTGATACATTAACCACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165949    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-519s1c1
Sequence:CCGGGCGATGTTCTGCAGGACAATTCTCGAGAATTGTCCTGCAGAACATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-954s1c1
Sequence:CCGGCAGAACACACAACCTTGCATACTCGAGTATGCAAGGTTGTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173793.3-315s21c1
Sequence:CCGGGAAGGACGAGTGACAAGCATCCTCGAGGATGCTTGTCACTCGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173793.3-325s21c1
Sequence:CCGGTGACAAGCATCCCTGCCATTGCTCGAGCAATGGCAGGGATGCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173793.3-90s21c1
Sequence:CCGGGCACTTCCTACACCACTACTACTCGAGTAGTAGTGGTGTAGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173793.3-98s21c1
Sequence:CCGGTACACCACTACTACGTCCACGCTCGAGCGTGGACGTAGTAGTGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173793.3-697s21c1
Sequence:CCGGGGTCATAATGAGGTAGCTAAACTCGAGTTTAGCTACCTCATTATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173793
C22orf39 MISSION shRNA shRNA Plasmid DNA
chromosome 22 open reading frame 39
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166018    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-685s1c1
Sequence:CCGGGACACACAGGTGGGTCATAATCTCGAGATTATGACCCACCTGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-726s1c1
Sequence:CCGGCCACTGTGAATGTCTTTCCTACTCGAGTAGGAAAGACATTCACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159410    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-1075s1c1
Sequence:CCGGGCCATTTCATCTGATTTCAAACTCGAGTTTGAAATCAGATGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162609    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-1053s1c1
Sequence:CCGGCCTGGTGGTTAATGTATCAAACTCGAGTTTGATACATTAACCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-994s1c1
Sequence:CCGGGCTGAAGAAATCCAAGTCCAACTCGAGTTGGACTTGGATTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-1052s1c1
Sequence:CCGGCCCTGGTGGTTAATGTATCAACTCGAGTTGATACATTAACCACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165949    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-519s1c1
Sequence:CCGGGCGATGTTCTGCAGGACAATTCTCGAGAATTGTCCTGCAGAACATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-954s1c1
Sequence:CCGGCAGAACACACAACCTTGCATACTCGAGTATGCAAGGTTGTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173793.3-315s21c1
Sequence:CCGGGAAGGACGAGTGACAAGCATCCTCGAGGATGCTTGTCACTCGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173793.3-325s21c1
Sequence:CCGGTGACAAGCATCCCTGCCATTGCTCGAGCAATGGCAGGGATGCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173793.3-90s21c1
Sequence:CCGGGCACTTCCTACACCACTACTACTCGAGTAGTAGTGGTGTAGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173793.3-98s21c1
Sequence:CCGGTACACCACTACTACGTCCACGCTCGAGCGTGGACGTAGTAGTGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173793.3-697s21c1
Sequence:CCGGGGTCATAATGAGGTAGCTAAACTCGAGTTTAGCTACCTCATTATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173793
C22orf39 MISSION shRNA Lentiviral Transduction Particles
chromosome 22 open reading frame 39
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166018    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-685s1c1
Sequence:CCGGGACACACAGGTGGGTCATAATCTCGAGATTATGACCCACCTGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163897    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-726s1c1
Sequence:CCGGCCACTGTGAATGTCTTTCCTACTCGAGTAGGAAAGACATTCACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159410    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-1075s1c1
Sequence:CCGGGCCATTTCATCTGATTTCAAACTCGAGTTTGAAATCAGATGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162609    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-1053s1c1
Sequence:CCGGCCTGGTGGTTAATGTATCAAACTCGAGTTTGATACATTAACCACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163354    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-994s1c1
Sequence:CCGGGCTGAAGAAATCCAAGTCCAACTCGAGTTGGACTTGGATTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-1052s1c1
Sequence:CCGGCCCTGGTGGTTAATGTATCAACTCGAGTTGATACATTAACCACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165949    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-519s1c1
Sequence:CCGGGCGATGTTCTGCAGGACAATTCTCGAGAATTGTCCTGCAGAACATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173793.3-954s1c1
Sequence:CCGGCAGAACACACAACCTTGCATACTCGAGTATGCAAGGTTGTGTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173793.3-315s21c1
Sequence:CCGGGAAGGACGAGTGACAAGCATCCTCGAGGATGCTTGTCACTCGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173793.3-325s21c1
Sequence:CCGGTGACAAGCATCCCTGCCATTGCTCGAGCAATGGCAGGGATGCTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173793.3-90s21c1
Sequence:CCGGGCACTTCCTACACCACTACTACTCGAGTAGTAGTGGTGTAGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173793.3-98s21c1
Sequence:CCGGTACACCACTACTACGTCCACGCTCGAGCGTGGACGTAGTAGTGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241528    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173793.3-697s21c1
Sequence:CCGGGGTCATAATGAGGTAGCTAAACTCGAGTTTAGCTACCTCATTATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks