EMAIL THIS PAGE TO A FRIEND

C22orf42

chromosome 22 open reading frame 42

Synonyms: dJ90G24.6
Species: Human C22orf42(150297)
UniProtKB ID: Q6IC83, A4QPH5
Gene ID:
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001010859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010859 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146691 MISSION® esiRNA esiRNA human C22orf42 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010859 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060214 predicted 556
2 SASI_Hs01_00060215 predicted 513
3 SASI_Hs01_00060216 predicted 572
4 SASI_Hs01_00060217 predicted 585
5 SASI_Hs01_00060218 predicted 196
6 SASI_Hs01_00060219 predicted 562
7 SASI_Hs01_00060220 predicted 524
8 SASI_Hs01_00060221 predicted 281
9 SASI_Hs01_00060222 predicted 244
10 SASI_Hs01_00060223 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010859
C22orf42 MISSION shRNA Bacterial Glycerol Stock
chromosome 22 open reading frame 42
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010859.1-714s21c1
Sequence:CCGGGATTACCTCTGCTGGGTTAAGCTCGAGCTTAACCCAGCAGAGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010859.1-578s21c1
Sequence:CCGGAGACTTCATGACATCGGATCTCTCGAGAGATCCGATGTCATGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010859.1-692s21c1
Sequence:CCGGGATGGCAAAGGAGAGATATGACTCGAGTCATATCTCTCCTTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-122s1c1
Sequence:CCGGCCATGAGTGTGAGATTCCTGACTCGAGTCAGGAATCTCACACTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-187s1c1
Sequence:CCGGCCAAATTGGATTTGAAAGCTACTCGAGTAGCTTTCAAATCCAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-390s1c1
Sequence:CCGGGAGGAGAATATGACATCAGATCTCGAGATCTGATGTCATATTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-483s1c1
Sequence:CCGGGAGGAGAATATAACGTCAGATCTCGAGATCTGACGTTATATTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-576s1c1
Sequence:CCGGGAAGACTTCATGACATCGGATCTCGAGATCCGATGTCATGAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-528s1c1
Sequence:CCGGGACCACCATTTGGTCGAAGATCTCGAGATCTTCGACCAAATGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-640s1c1
Sequence:CCGGCAGGTCTCAGTGAAAGCCTATCTCGAGATAGGCTTTCACTGAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-257s1c1
Sequence:CCGGGCTGAAGATGTCCAAAGGTTTCTCGAGAAACCTTTGGACATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010859
C22orf42 MISSION shRNA shRNA Plasmid DNA
chromosome 22 open reading frame 42
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010859.1-714s21c1
Sequence:CCGGGATTACCTCTGCTGGGTTAAGCTCGAGCTTAACCCAGCAGAGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010859.1-578s21c1
Sequence:CCGGAGACTTCATGACATCGGATCTCTCGAGAGATCCGATGTCATGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010859.1-692s21c1
Sequence:CCGGGATGGCAAAGGAGAGATATGACTCGAGTCATATCTCTCCTTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-122s1c1
Sequence:CCGGCCATGAGTGTGAGATTCCTGACTCGAGTCAGGAATCTCACACTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-187s1c1
Sequence:CCGGCCAAATTGGATTTGAAAGCTACTCGAGTAGCTTTCAAATCCAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-390s1c1
Sequence:CCGGGAGGAGAATATGACATCAGATCTCGAGATCTGATGTCATATTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-483s1c1
Sequence:CCGGGAGGAGAATATAACGTCAGATCTCGAGATCTGACGTTATATTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-576s1c1
Sequence:CCGGGAAGACTTCATGACATCGGATCTCGAGATCCGATGTCATGAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-528s1c1
Sequence:CCGGGACCACCATTTGGTCGAAGATCTCGAGATCTTCGACCAAATGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-640s1c1
Sequence:CCGGCAGGTCTCAGTGAAAGCCTATCTCGAGATAGGCTTTCACTGAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-257s1c1
Sequence:CCGGGCTGAAGATGTCCAAAGGTTTCTCGAGAAACCTTTGGACATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010859
C22orf42 MISSION shRNA Lentiviral Transduction Particles
chromosome 22 open reading frame 42
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010859.1-714s21c1
Sequence:CCGGGATTACCTCTGCTGGGTTAAGCTCGAGCTTAACCCAGCAGAGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010859.1-578s21c1
Sequence:CCGGAGACTTCATGACATCGGATCTCTCGAGAGATCCGATGTCATGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010859.1-692s21c1
Sequence:CCGGGATGGCAAAGGAGAGATATGACTCGAGTCATATCTCTCCTTTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-122s1c1
Sequence:CCGGCCATGAGTGTGAGATTCCTGACTCGAGTCAGGAATCTCACACTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-187s1c1
Sequence:CCGGCCAAATTGGATTTGAAAGCTACTCGAGTAGCTTTCAAATCCAATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-390s1c1
Sequence:CCGGGAGGAGAATATGACATCAGATCTCGAGATCTGATGTCATATTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-483s1c1
Sequence:CCGGGAGGAGAATATAACGTCAGATCTCGAGATCTGACGTTATATTCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162988    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-576s1c1
Sequence:CCGGGAAGACTTCATGACATCGGATCTCGAGATCCGATGTCATGAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165075    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-528s1c1
Sequence:CCGGGACCACCATTTGGTCGAAGATCTCGAGATCTTCGACCAAATGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-640s1c1
Sequence:CCGGCAGGTCTCAGTGAAAGCCTATCTCGAGATAGGCTTTCACTGAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010859.1-257s1c1
Sequence:CCGGGCTGAAGATGTCCAAAGGTTTCTCGAGAAACCTTTGGACATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks