EMAIL THIS PAGE TO A FRIEND

C22orf43

chromosome 22 open reading frame 43

17 Gene Product Result for
Species: Human C22orf43(51233)
UniProtKB ID: Q6PGQ1, Q6ICJ8, Q6P4I3, Q9NU31
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016449 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100961 MISSION® esiRNA esiRNA human AP000346.1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016449 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130971 predicted 363
2 SASI_Hs01_00130972 predicted 331
3 SASI_Hs01_00130973 predicted 335
4 SASI_Hs01_00130974 predicted 334
5 SASI_Hs01_00130975 predicted 324
6 SASI_Hs01_00130976 predicted 288
7 SASI_Hs01_00130977 predicted 339
8 SASI_Hs01_00130978 predicted 1044
9 SASI_Hs01_00130979 predicted 1043
10 SASI_Hs01_00130980 predicted 344
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016449
C22orf43 MISSION shRNA Bacterial Glycerol Stock
chromosome 22 open reading frame 43
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-745s1c1
Sequence:CCGGCCTACCACGAAGTGAAGATGACTCGAGTCATCTTCACTTCGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-337s1c1
Sequence:CCGGCGCACCCTGTTATGAATCTGACTCGAGTCAGATTCATAACAGGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-934s1c1
Sequence:CCGGGAGTCTAAGTGATGAAGAGATCTCGAGATCTCTTCATCACTTAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-386s1c1
Sequence:CCGGGCAACATCAGAATCCACTACTCTCGAGAGTAGTGGATTCTGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-722s1c1
Sequence:CCGGGAGGACAACCTGAGTTTAGTACTCGAGTACTAAACTCAGGTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-338s1c1
Sequence:CCGGGCACCCTGTTATGAATCTGATCTCGAGATCAGATTCATAACAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-695s1c1
Sequence:CCGGCGGTTTGATAGCAGTTCTTGTCTCGAGACAAGAACTGCTATCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-521s1c1
Sequence:CCGGCCATCAAGTGAGGAAGACAATCTCGAGATTGTCTTCCTCACTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-892s1c1
Sequence:CCGGCATCCACATAACAGCTCGGATCTCGAGATCCGAGCTGTTATGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-602s1c1
Sequence:CCGGGTATGCCTACCACGAAGTGAACTCGAGTTCACTTCGTGGTAGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016449
C22orf43 MISSION shRNA shRNA Plasmid DNA
chromosome 22 open reading frame 43
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-745s1c1
Sequence:CCGGCCTACCACGAAGTGAAGATGACTCGAGTCATCTTCACTTCGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-337s1c1
Sequence:CCGGCGCACCCTGTTATGAATCTGACTCGAGTCAGATTCATAACAGGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-934s1c1
Sequence:CCGGGAGTCTAAGTGATGAAGAGATCTCGAGATCTCTTCATCACTTAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-386s1c1
Sequence:CCGGGCAACATCAGAATCCACTACTCTCGAGAGTAGTGGATTCTGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-722s1c1
Sequence:CCGGGAGGACAACCTGAGTTTAGTACTCGAGTACTAAACTCAGGTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-338s1c1
Sequence:CCGGGCACCCTGTTATGAATCTGATCTCGAGATCAGATTCATAACAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-695s1c1
Sequence:CCGGCGGTTTGATAGCAGTTCTTGTCTCGAGACAAGAACTGCTATCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-521s1c1
Sequence:CCGGCCATCAAGTGAGGAAGACAATCTCGAGATTGTCTTCCTCACTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-892s1c1
Sequence:CCGGCATCCACATAACAGCTCGGATCTCGAGATCCGAGCTGTTATGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-602s1c1
Sequence:CCGGGTATGCCTACCACGAAGTGAACTCGAGTTCACTTCGTGGTAGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016449
C22orf43 MISSION shRNA Lentiviral Transduction Particles
chromosome 22 open reading frame 43
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-745s1c1
Sequence:CCGGCCTACCACGAAGTGAAGATGACTCGAGTCATCTTCACTTCGTGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166183    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-337s1c1
Sequence:CCGGCGCACCCTGTTATGAATCTGACTCGAGTCAGATTCATAACAGGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160908    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-934s1c1
Sequence:CCGGGAGTCTAAGTGATGAAGAGATCTCGAGATCTCTTCATCACTTAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-386s1c1
Sequence:CCGGGCAACATCAGAATCCACTACTCTCGAGAGTAGTGGATTCTGATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-722s1c1
Sequence:CCGGGAGGACAACCTGAGTTTAGTACTCGAGTACTAAACTCAGGTTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-338s1c1
Sequence:CCGGGCACCCTGTTATGAATCTGATCTCGAGATCAGATTCATAACAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-695s1c1
Sequence:CCGGCGGTTTGATAGCAGTTCTTGTCTCGAGACAAGAACTGCTATCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-521s1c1
Sequence:CCGGCCATCAAGTGAGGAAGACAATCTCGAGATTGTCTTCCTCACTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164710    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-892s1c1
Sequence:CCGGCATCCACATAACAGCTCGGATCTCGAGATCCGAGCTGTTATGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016449.2-602s1c1
Sequence:CCGGGTATGCCTACCACGAAGTGAACTCGAGTTCACTTCGTGGTAGGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks