EMAIL THIS PAGE TO A FRIEND

C22orf46

chromosome 22 open reading frame 46

46 Gene Product Result for
Species: Human C22orf46(79640)
UniProtKB ID: C9J442
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024588 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024588 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024588 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024588 Rosetta Predictions human pricing
XR_040813 Rosetta Predictions human pricing
XR_040814 Rosetta Predictions human pricing
XR_040815 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191934 predicted 4011
2 SASI_Hs01_00191935 predicted 4058
3 SASI_Hs01_00191936 predicted 4317
4 SASI_Hs01_00191937 predicted 4358
5 SASI_Hs01_00191938 predicted 4506
6 SASI_Hs01_00191939 predicted 3583
7 SASI_Hs01_00191940 predicted 3988
8 SASI_Hs01_00191941 predicted 4490
9 SASI_Hs01_00191942 predicted 4058
10 SASI_Hs01_00191943 predicted 4520
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522159 predicted 2112
2 SASI_Hs02_00522160 predicted 1027
3 SASI_Hs02_00522161 predicted 1231
4 SASI_Hs02_00522162 predicted 2796
5 SASI_Hs02_00522163 predicted 2270
6 SASI_Hs02_00522164 predicted 4496
7 SASI_Hs02_00522165 predicted 1399
8 SASI_Hs02_00522166 predicted 1060
9 SASI_Hs02_00522167 predicted 2264
10 SASI_Hs02_00522168 predicted 1506
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040814 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522169 predicted 2111
2 SASI_Hs02_00522170 predicted 1031
3 SASI_Hs02_00522171 predicted 1227
4 SASI_Hs02_00522172 predicted 2793
5 SASI_Hs02_00522173 predicted 2278
6 SASI_Hs02_00522174 predicted 4497
7 SASI_Hs02_00522175 predicted 1394
8 SASI_Hs02_00522176 predicted 1061
9 SASI_Hs02_00522177 predicted 2273
10 SASI_Hs02_00522178 predicted 1505
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00522179 predicted 2105
2 SASI_Hs02_00522180 predicted 1036
3 SASI_Hs02_00522181 predicted 1228
4 SASI_Hs02_00522182 predicted 2791
5 SASI_Hs02_00522183 predicted 2280
6 SASI_Hs02_00522184 predicted 4501
7 SASI_Hs02_00522185 predicted 1398
8 SASI_Hs02_00522186 predicted 1057
9 SASI_Hs02_00522187 predicted 2266
10 SASI_Hs02_00522188 predicted 1511
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024588
C22orf46 MISSION shRNA Bacterial Glycerol Stock
chromosome 22 open reading frame 46
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024588.3-3534s1c1
Sequence:CCGGGAAGACGACAAAGGGACAAAGCTCGAGCTTTGTCCCTTTGTCGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024588.3-4491s1c1
Sequence:CCGGGCAGAACCTGTCAGCTTCAAACTCGAGTTTGAAGCTGACAGGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024588.3-4011s1c1
Sequence:CCGGCGAAACTTCCTATACAAGCCACTCGAGTGGCTTGTATAGGAAGTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024588.3-3841s1c1
Sequence:CCGGCTTCTTAGGATCTTGCTCATTCTCGAGAATGAGCAAGATCCTAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024588.3-4067s1c1
Sequence:CCGGCCCATTAAGCATTTCCATCCACTCGAGTGGATGGAAATGCTTAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024588.3-3818s1c1
Sequence:CCGGCTGGAGTCCTATTTCCTGTTTCTCGAGAAACAGGAAATAGGACTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024588.3-4068s1c1
Sequence:CCGGCCATTAAGCATTTCCATCCAGCTCGAGCTGGATGGAAATGCTTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024588.3-4429s1c1
Sequence:CCGGGAAGAGGAAGCCTGGAATCTACTCGAGTAGATTCCAGGCTTCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024588.3-4629s1c1
Sequence:CCGGGATTCTACTCTGCCTCCCAAACTCGAGTTTGGGAGGCAGAGTAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024588
C22orf46 MISSION shRNA shRNA Plasmid DNA
chromosome 22 open reading frame 46
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024588.3-3534s1c1
Sequence:CCGGGAAGACGACAAAGGGACAAAGCTCGAGCTTTGTCCCTTTGTCGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024588.3-4491s1c1
Sequence:CCGGGCAGAACCTGTCAGCTTCAAACTCGAGTTTGAAGCTGACAGGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024588.3-4011s1c1
Sequence:CCGGCGAAACTTCCTATACAAGCCACTCGAGTGGCTTGTATAGGAAGTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024588.3-3841s1c1
Sequence:CCGGCTTCTTAGGATCTTGCTCATTCTCGAGAATGAGCAAGATCCTAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024588.3-4067s1c1
Sequence:CCGGCCCATTAAGCATTTCCATCCACTCGAGTGGATGGAAATGCTTAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024588.3-3818s1c1
Sequence:CCGGCTGGAGTCCTATTTCCTGTTTCTCGAGAAACAGGAAATAGGACTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024588.3-4068s1c1
Sequence:CCGGCCATTAAGCATTTCCATCCAGCTCGAGCTGGATGGAAATGCTTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024588.3-4429s1c1
Sequence:CCGGGAAGAGGAAGCCTGGAATCTACTCGAGTAGATTCCAGGCTTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024588.3-4629s1c1
Sequence:CCGGGATTCTACTCTGCCTCCCAAACTCGAGTTTGGGAGGCAGAGTAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024588
C22orf46 MISSION shRNA Lentiviral Transduction Particles
chromosome 22 open reading frame 46
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024588.3-3534s1c1
Sequence:CCGGGAAGACGACAAAGGGACAAAGCTCGAGCTTTGTCCCTTTGTCGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137831    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024588.3-4491s1c1
Sequence:CCGGGCAGAACCTGTCAGCTTCAAACTCGAGTTTGAAGCTGACAGGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024588.3-4011s1c1
Sequence:CCGGCGAAACTTCCTATACAAGCCACTCGAGTGGCTTGTATAGGAAGTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024588.3-3841s1c1
Sequence:CCGGCTTCTTAGGATCTTGCTCATTCTCGAGAATGAGCAAGATCCTAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024588.3-4067s1c1
Sequence:CCGGCCCATTAAGCATTTCCATCCACTCGAGTGGATGGAAATGCTTAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024588.3-3818s1c1
Sequence:CCGGCTGGAGTCCTATTTCCTGTTTCTCGAGAAACAGGAAATAGGACTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024588.3-4068s1c1
Sequence:CCGGCCATTAAGCATTTCCATCCAGCTCGAGCTGGATGGAAATGCTTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024588.3-4429s1c1
Sequence:CCGGGAAGAGGAAGCCTGGAATCTACTCGAGTAGATTCCAGGCTTCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024588.3-4629s1c1
Sequence:CCGGGATTCTACTCTGCCTCCCAAACTCGAGTTTGGGAGGCAGAGTAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)