EMAIL THIS PAGE TO A FRIEND

C2

complement component 2

80 Gene Product Result for
Synonyms: CO2
UniProtKB ID: P06681, B4DPF3, B4DV20, E9PFN7, O19694, Q13904
Gene ID:
Human(717) Summary: Component C2 is a serum glycoprotein that functions as part of the classical pathway of the complement system. Activated C1 cleaves C2 into C2a and C2b. The serine proteinase C2a then combines with complement factor 4b to create the C3 or C5 convertase. Deficiency of C2 has been reported to associated with certain autoimmune diseases and SNPs in this gene have been associated with altered susceptibility to age-related macular degeneration. This gene localizes within the class III region of the MHC on the short arm of chromosome 6. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described in publications but their full-length sequence has not been determined.[provided by RefSeq, Mar 2009]
Mouse(12263) complement component 2 (within H-2S)
Rat(24231) complement component 2
naked mole-rat(101723809) complement component 2
domestic guinea pig(100716184) complement component 2
sheep(101115321) complement component 2
Domestic Rabbit(100355553) complement component 2
chicken(419574) complement component 2
cow(515440) complement component 2
Horse(100059162) complement component 2
domestic cat(101092434) complement component 2
dog(474853) complement component 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
C0913 Complement C2 deficient serum human for complement assays human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000063 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000063 Rosetta Predictions human pricing
NM_172222 Rosetta Predictions rat pricing
NM_013484 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157811 predicted 2348
2 SASI_Hs02_00301779 predicted 1189
3 SASI_Hs01_00157813 predicted 1890
4 SASI_Hs01_00157814 predicted 1155
5 SASI_Hs01_00157815 predicted 2364
6 SASI_Hs01_00157816 predicted 266
7 SASI_Hs01_00157817 predicted 1692
8 SASI_Hs01_00157818 predicted 448
9 SASI_Hs01_00157820 predicted 1190
10 SASI_Hs02_00301780 predicted 661
11 SASI_Hs01_00157812 predicted 1904
12 SASI_Hs01_00157819 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269195 predicted 1777
2 SASI_Rn01_00112112 predicted 1777
3 SASI_Rn01_00112113 predicted 594
4 SASI_Rn01_00112114 predicted 1546
5 SASI_Rn01_00112115 predicted 655
6 SASI_Rn01_00112116 predicted 1124
7 SASI_Rn01_00112117 predicted 1066
8 SASI_Rn01_00112118 predicted 353
9 SASI_Rn01_00112119 predicted 1210
10 SASI_Rn01_00112120 predicted 1406
11 SASI_Rn01_00112121 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092184 predicted 1960
2 SASI_Mm01_00092185 predicted 1793
3 SASI_Mm02_00322123 predicted 719
4 SASI_Mm01_00092186 predicted 1153
5 SASI_Mm01_00092187 predicted 1945
6 SASI_Mm01_00092189 predicted 658
7 SASI_Mm01_00092190 predicted 1750
8 SASI_Mm01_00092192 predicted 1561
9 SASI_Mm01_00092193 predicted 957
10 SASI_Mm02_00322124 predicted 2043
11 SASI_Mm01_00092188 predicted 2347
12 SASI_Mm01_00092191 predicted 1432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000063
C2 MISSION shRNA Bacterial Glycerol Stock
complement component 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000063.4-332s21c1
Sequence:CCGGCCTGCCCTCAGAACGTGAATACTCGAGTATTCACGTTCTGAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000063.4-1386s21c1
Sequence:CCGGGACAGATGGAAAGTCCAATATCTCGAGATATTGGACTTTCCATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000063.4-1275s21c1
Sequence:CCGGTAACACCTATGCGGCCTTAAACTCGAGTTTAAGGCCGCATAGGTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000063.x-2208s1c1
Sequence:CCGGGCCACGAGACTTTCACATCAACTCGAGTTGATGTGAAAGTCTCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000063.x-1012s1c1
Sequence:CCGGGCCAACTATAAAGATCATGAACTCGAGTTCATGATCTTTATAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000063.x-1476s1c1
Sequence:CCGGGCATGTCACTATTAAGCCCAACTCGAGTTGGGCTTAATAGTGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000063.x-651s1c1
Sequence:CCGGCCAACCCTACTCTTATGACTTCTCGAGAAGTCATAAGAGTAGGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000063.x-2540s1c1
Sequence:CCGGGACTCATGCTTGTTTCACTTTCTCGAGAAAGTGAAACAAGCATGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000063
C2 MISSION shRNA shRNA Plasmid DNA
complement component 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000063.4-332s21c1
Sequence:CCGGCCTGCCCTCAGAACGTGAATACTCGAGTATTCACGTTCTGAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000063.4-1386s21c1
Sequence:CCGGGACAGATGGAAAGTCCAATATCTCGAGATATTGGACTTTCCATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000063.4-1275s21c1
Sequence:CCGGTAACACCTATGCGGCCTTAAACTCGAGTTTAAGGCCGCATAGGTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000063.x-2208s1c1
Sequence:CCGGGCCACGAGACTTTCACATCAACTCGAGTTGATGTGAAAGTCTCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000063.x-1012s1c1
Sequence:CCGGGCCAACTATAAAGATCATGAACTCGAGTTCATGATCTTTATAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000063.x-1476s1c1
Sequence:CCGGGCATGTCACTATTAAGCCCAACTCGAGTTGGGCTTAATAGTGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000063.x-651s1c1
Sequence:CCGGCCAACCCTACTCTTATGACTTCTCGAGAAGTCATAAGAGTAGGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000063.x-2540s1c1
Sequence:CCGGGACTCATGCTTGTTTCACTTTCTCGAGAAAGTGAAACAAGCATGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000063
C2 MISSION shRNA Lentiviral Transduction Particles
complement component 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000063.4-332s21c1
Sequence:CCGGCCTGCCCTCAGAACGTGAATACTCGAGTATTCACGTTCTGAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000063.4-1386s21c1
Sequence:CCGGGACAGATGGAAAGTCCAATATCTCGAGATATTGGACTTTCCATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000063.4-1275s21c1
Sequence:CCGGTAACACCTATGCGGCCTTAAACTCGAGTTTAAGGCCGCATAGGTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000063.x-2208s1c1
Sequence:CCGGGCCACGAGACTTTCACATCAACTCGAGTTGATGTGAAAGTCTCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000063.x-1012s1c1
Sequence:CCGGGCCAACTATAAAGATCATGAACTCGAGTTCATGATCTTTATAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000063.x-1476s1c1
Sequence:CCGGGCATGTCACTATTAAGCCCAACTCGAGTTGGGCTTAATAGTGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000063.x-651s1c1
Sequence:CCGGCCAACCCTACTCTTATGACTTCTCGAGAAGTCATAAGAGTAGGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000063.x-2540s1c1
Sequence:CCGGGACTCATGCTTGTTTCACTTTCTCGAGAAAGTGAAACAAGCATGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013484
VALIDATED
C2 MISSION shRNA Bacterial Glycerol Stock
complement component 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013484.2-1103s21c1
Sequence:CCGGCCAGCTACAAAGATCACGAAACTCGAGTTTCGTGATCTTTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013484.2-650s21c1
Sequence:CCGGGCTCCTCCTCAAATATGGTATCTCGAGATACCATATTTGAGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013484.2-1962s21c1
Sequence:CCGGGCAGAAAGTTCCTGCACATTTCTCGAGAAATGTGCAGGAACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013484.2-2367s21c1
Sequence:CCGGCCTGGACTTTCTGCCACTTTACTCGAGTAAAGTGGCAGAAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-1050s1c1
Sequence:CCGGCCAGCTACAAAGATCACGAAACTCGAGTTTCGTGATCTTTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-597s1c1
Sequence:CCGGGCTCCTCCTCAAATATGGTATCTCGAGATACCATATTTGAGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-1909s1c1
Sequence:CCGGGCAGAAAGTTCCTGCACATTTCTCGAGAAATGTGCAGGAACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-1704s1c1
Sequence:CCGGCAGGGTTTAATGTCCATGCAACTCGAGTTGCATGGACATTAAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-2314s1c1
Sequence:CCGGCCTGGACTTTCTGCCACTTTACTCGAGTAAAGTGGCAGAAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013484
VALIDATED
C2 MISSION shRNA shRNA Plasmid DNA
complement component 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013484.2-1103s21c1
Sequence:CCGGCCAGCTACAAAGATCACGAAACTCGAGTTTCGTGATCTTTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013484.2-650s21c1
Sequence:CCGGGCTCCTCCTCAAATATGGTATCTCGAGATACCATATTTGAGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013484.2-1962s21c1
Sequence:CCGGGCAGAAAGTTCCTGCACATTTCTCGAGAAATGTGCAGGAACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013484.2-2367s21c1
Sequence:CCGGCCTGGACTTTCTGCCACTTTACTCGAGTAAAGTGGCAGAAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-1050s1c1
Sequence:CCGGCCAGCTACAAAGATCACGAAACTCGAGTTTCGTGATCTTTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-597s1c1
Sequence:CCGGGCTCCTCCTCAAATATGGTATCTCGAGATACCATATTTGAGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-1909s1c1
Sequence:CCGGGCAGAAAGTTCCTGCACATTTCTCGAGAAATGTGCAGGAACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-1704s1c1
Sequence:CCGGCAGGGTTTAATGTCCATGCAACTCGAGTTGCATGGACATTAAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-2314s1c1
Sequence:CCGGCCTGGACTTTCTGCCACTTTACTCGAGTAAAGTGGCAGAAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013484
VALIDATED
C2 MISSION shRNA Lentiviral Transduction Particles
complement component 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013484.2-1103s21c1
Sequence:CCGGCCAGCTACAAAGATCACGAAACTCGAGTTTCGTGATCTTTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013484.2-650s21c1
Sequence:CCGGGCTCCTCCTCAAATATGGTATCTCGAGATACCATATTTGAGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013484.2-1962s21c1
Sequence:CCGGGCAGAAAGTTCCTGCACATTTCTCGAGAAATGTGCAGGAACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013484.2-2367s21c1
Sequence:CCGGCCTGGACTTTCTGCCACTTTACTCGAGTAAAGTGGCAGAAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-1050s1c1
Sequence:CCGGCCAGCTACAAAGATCACGAAACTCGAGTTTCGTGATCTTTGTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-597s1c1
Sequence:CCGGGCTCCTCCTCAAATATGGTATCTCGAGATACCATATTTGAGGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-1909s1c1
Sequence:CCGGGCAGAAAGTTCCTGCACATTTCTCGAGAAATGTGCAGGAACTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-1704s1c1
Sequence:CCGGCAGGGTTTAATGTCCATGCAACTCGAGTTGCATGGACATTAAACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013484.1-2314s1c1
Sequence:CCGGCCTGGACTTTCTGCCACTTTACTCGAGTAAAGTGGCAGAAAGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks