EMAIL THIS PAGE TO A FRIEND

C2CD2L

C2CD2-like

144 Gene Product Result for
Synonyms: TMEM24
UniProtKB ID: O14523, Q86UT7, Q86V04, Q8N522, Q8TBN4, Q96G10
Gene ID:
Mouse(71764) C2 calcium-dependent domain containing 2-like
Rat(300666) C2CD2-like
sheep(101107467) C2CD2-like
Zebrafish(566488) c2cd2-like
cow(511966) C2CD2-like
Horse(100071353) C2CD2-like
chicken(428233) C2CD2-like
dog(610622) C2CD2-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014807 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014807 Rosetta Predictions human pricing
NM_001011996 Rosetta Predictions rat pricing
XM_576398 Rosetta Predictions rat pricing
NM_027909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069974 predicted 2808
2 SASI_Hs01_00069975 predicted 2494
3 SASI_Hs01_00069976 predicted 2187
4 SASI_Hs01_00069978 predicted 2157
5 SASI_Hs01_00069979 predicted 1203
6 SASI_Hs02_00346327 predicted 2387
7 SASI_Hs01_00069980 predicted 1870
8 SASI_Hs01_00069981 predicted 1888
9 SASI_Hs01_00069982 predicted 2342
10 SASI_Hs01_00069983 predicted 1560
11 SASI_Hs01_00069977 predicted 2495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011996 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032390 predicted 1663
2 SASI_Rn01_00032392 predicted 1044
3 SASI_Rn01_00032393 predicted 715
4 SASI_Rn01_00032394 predicted 1232
5 SASI_Rn01_00032395 predicted 2160
6 SASI_Rn02_00200044 predicted 625
7 SASI_Rn01_00032396 predicted 1049
8 SASI_Rn01_00032397 predicted 1952
9 SASI_Rn01_00032398 predicted 1349
10 SASI_Rn02_00200045 predicted 2565
11 SASI_Rn01_00032391 predicted 1732
12 SASI_Rn01_00032399 predicted 2388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167559 predicted 1051
2 SASI_Rn01_00167560 predicted 723
3 SASI_Rn01_00167561 predicted 1236
4 SASI_Rn01_00167562 predicted 2164
5 SASI_Rn01_00167563 predicted 629
6 SASI_Rn01_00167564 predicted 1057
7 SASI_Rn01_00167565 predicted 1955
8 SASI_Rn01_00167566 predicted 1354
9 SASI_Rn01_00167567 predicted 2389
10 SASI_Rn01_00167568 predicted 2567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148434 predicted 754
2 SASI_Mm01_00148436 predicted 2197
3 SASI_Mm01_00148437 predicted 2602
4 SASI_Mm01_00148438 predicted 2421
5 SASI_Mm02_00332885 predicted 1987
6 SASI_Mm01_00148439 predicted 2416
7 SASI_Mm01_00148440 predicted 2234
8 SASI_Mm01_00148441 predicted 748
9 SASI_Mm01_00148442 predicted 2074
10 SASI_Mm01_00148443 predicted 2530
11 SASI_Mm01_00148435 predicted 1769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014807
C2CD2L MISSION shRNA Bacterial Glycerol Stock
C2CD2-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014807.3-1726s21c1
Sequence:CCGGCCCGTATAGACGGCAAATTAGCTCGAGCTAATTTGCCGTCTATACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014807.3-2194s21c1
Sequence:CCGGGGCCATCTGTGGATGATATTGCTCGAGCAATATCATCCACAGATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014807.3-2811s1c1
Sequence:CCGGGCTGACCCTTCTTCCCTTATTCTCGAGAATAAGGGAAGAAGGGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014807.3-2629s1c1
Sequence:CCGGGAAGGATACTTGGAACGGGAACTCGAGTTCCCGTTCCAAGTATCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014807.3-2258s1c1
Sequence:CCGGCAAGGATCACAAAGTGAGTTTCTCGAGAAACTCACTTTGTGATCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014807.3-1064s1c1
Sequence:CCGGCTCCACAATTGAGGAACTGATCTCGAGATCAGTTCCTCAATTGTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014807.3-1077s1c1
Sequence:CCGGGAACTGATCAAGGATGCCATACTCGAGTATGGCATCCTTGATCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014807.3-641s1c1
Sequence:CCGGCTTCAAGTCTTTCCGGGAGAACTCGAGTTCTCCCGGAAAGACTTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014807.3-2254s1c1
Sequence:CCGGGCCTCAAGGATCACAAAGTGACTCGAGTCACTTTGTGATCCTTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014807
C2CD2L MISSION shRNA shRNA Plasmid DNA
C2CD2-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014807.3-1726s21c1
Sequence:CCGGCCCGTATAGACGGCAAATTAGCTCGAGCTAATTTGCCGTCTATACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014807.3-2194s21c1
Sequence:CCGGGGCCATCTGTGGATGATATTGCTCGAGCAATATCATCCACAGATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014807.3-2811s1c1
Sequence:CCGGGCTGACCCTTCTTCCCTTATTCTCGAGAATAAGGGAAGAAGGGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014807.3-2629s1c1
Sequence:CCGGGAAGGATACTTGGAACGGGAACTCGAGTTCCCGTTCCAAGTATCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014807.3-2258s1c1
Sequence:CCGGCAAGGATCACAAAGTGAGTTTCTCGAGAAACTCACTTTGTGATCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014807.3-1064s1c1
Sequence:CCGGCTCCACAATTGAGGAACTGATCTCGAGATCAGTTCCTCAATTGTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014807.3-1077s1c1
Sequence:CCGGGAACTGATCAAGGATGCCATACTCGAGTATGGCATCCTTGATCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014807.3-641s1c1
Sequence:CCGGCTTCAAGTCTTTCCGGGAGAACTCGAGTTCTCCCGGAAAGACTTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014807.3-2254s1c1
Sequence:CCGGGCCTCAAGGATCACAAAGTGACTCGAGTCACTTTGTGATCCTTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014807
C2CD2L MISSION shRNA Lentiviral Transduction Particles
C2CD2-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014807.3-1726s21c1
Sequence:CCGGCCCGTATAGACGGCAAATTAGCTCGAGCTAATTTGCCGTCTATACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014807.3-2194s21c1
Sequence:CCGGGGCCATCTGTGGATGATATTGCTCGAGCAATATCATCCACAGATGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014807.3-2811s1c1
Sequence:CCGGGCTGACCCTTCTTCCCTTATTCTCGAGAATAAGGGAAGAAGGGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014807.3-2629s1c1
Sequence:CCGGGAAGGATACTTGGAACGGGAACTCGAGTTCCCGTTCCAAGTATCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014807.3-2258s1c1
Sequence:CCGGCAAGGATCACAAAGTGAGTTTCTCGAGAAACTCACTTTGTGATCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014807.3-1064s1c1
Sequence:CCGGCTCCACAATTGAGGAACTGATCTCGAGATCAGTTCCTCAATTGTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014807.3-1077s1c1
Sequence:CCGGGAACTGATCAAGGATGCCATACTCGAGTATGGCATCCTTGATCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014807.3-641s1c1
Sequence:CCGGCTTCAAGTCTTTCCGGGAGAACTCGAGTTCTCCCGGAAAGACTTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014807.3-2254s1c1
Sequence:CCGGGCCTCAAGGATCACAAAGTGACTCGAGTCACTTTGTGATCCTTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027909
VALIDATED
C2CD2L MISSION shRNA Bacterial Glycerol Stock
C2CD2-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027909.2-1993s21c1
Sequence:CCGGGCTCATCATCTCTGGTGTTTCCTCGAGGAAACACCAGAGATGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027909.2-2606s21c1
Sequence:CCGGCAGGAAAGCCCTCGGGTTATACTCGAGTATAACCCGAGGGCTTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027909.2-1594s21c1
Sequence:CCGGCGTGACAGCGGAGCTACATTACTCGAGTAATGTAGCTCCGCTGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027909.2-2443s21c1
Sequence:CCGGCCGTCGCCTTATCAAGCGTTTCTCGAGAAACGCTTGATAAGGCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027909.2-752s21c1
Sequence:CCGGTCCATCCAAATCGCCTTTGAACTCGAGTTCAAAGGCGATTTGGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-2307s1c1
Sequence:CCGGCCGTCGCCTTATCAAGCGTTTCTCGAGAAACGCTTGATAAGGCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-2707s1c1
Sequence:CCGGCTCCCTTATTTATTCTCGTTTCTCGAGAAACGAGAATAAATAAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-1943s1c1
Sequence:CCGGCGATGCAAGATGATGCAGGAACTCGAGTTCCTGCATCATCTTGCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-1117s1c1
Sequence:CCGGCGATTATTCTTACGGCAGCTTCTCGAGAAGCTGCCGTAAGAATAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-616s1c1
Sequence:CCGGTCCATCCAAATCGCCTTTGAACTCGAGTTCAAAGGCGATTTGGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027909
VALIDATED
C2CD2L MISSION shRNA shRNA Plasmid DNA
C2CD2-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027909.2-1993s21c1
Sequence:CCGGGCTCATCATCTCTGGTGTTTCCTCGAGGAAACACCAGAGATGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027909.2-2606s21c1
Sequence:CCGGCAGGAAAGCCCTCGGGTTATACTCGAGTATAACCCGAGGGCTTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027909.2-1594s21c1
Sequence:CCGGCGTGACAGCGGAGCTACATTACTCGAGTAATGTAGCTCCGCTGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027909.2-2443s21c1
Sequence:CCGGCCGTCGCCTTATCAAGCGTTTCTCGAGAAACGCTTGATAAGGCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027909.2-752s21c1
Sequence:CCGGTCCATCCAAATCGCCTTTGAACTCGAGTTCAAAGGCGATTTGGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-2307s1c1
Sequence:CCGGCCGTCGCCTTATCAAGCGTTTCTCGAGAAACGCTTGATAAGGCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-2707s1c1
Sequence:CCGGCTCCCTTATTTATTCTCGTTTCTCGAGAAACGAGAATAAATAAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-1943s1c1
Sequence:CCGGCGATGCAAGATGATGCAGGAACTCGAGTTCCTGCATCATCTTGCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-1117s1c1
Sequence:CCGGCGATTATTCTTACGGCAGCTTCTCGAGAAGCTGCCGTAAGAATAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-616s1c1
Sequence:CCGGTCCATCCAAATCGCCTTTGAACTCGAGTTCAAAGGCGATTTGGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027909
VALIDATED
C2CD2L MISSION shRNA Lentiviral Transduction Particles
C2CD2-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027909.2-1993s21c1
Sequence:CCGGGCTCATCATCTCTGGTGTTTCCTCGAGGAAACACCAGAGATGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027909.2-2606s21c1
Sequence:CCGGCAGGAAAGCCCTCGGGTTATACTCGAGTATAACCCGAGGGCTTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027909.2-1594s21c1
Sequence:CCGGCGTGACAGCGGAGCTACATTACTCGAGTAATGTAGCTCCGCTGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027909.2-2443s21c1
Sequence:CCGGCCGTCGCCTTATCAAGCGTTTCTCGAGAAACGCTTGATAAGGCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027909.2-752s21c1
Sequence:CCGGTCCATCCAAATCGCCTTTGAACTCGAGTTCAAAGGCGATTTGGATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-2307s1c1
Sequence:CCGGCCGTCGCCTTATCAAGCGTTTCTCGAGAAACGCTTGATAAGGCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-2707s1c1
Sequence:CCGGCTCCCTTATTTATTCTCGTTTCTCGAGAAACGAGAATAAATAAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-1943s1c1
Sequence:CCGGCGATGCAAGATGATGCAGGAACTCGAGTTCCTGCATCATCTTGCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-1117s1c1
Sequence:CCGGCGATTATTCTTACGGCAGCTTCTCGAGAAGCTGCCGTAAGAATAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027909.1-616s1c1
Sequence:CCGGTCCATCCAAATCGCCTTTGAACTCGAGTTCAAAGGCGATTTGGATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)