EMAIL THIS PAGE TO A FRIEND

C2CD3

C2 calcium-dependent domain containing 3

63 Gene Product Result for
Gene ID:
Mouse(277939) C2 calcium-dependent domain containing 3
Rat(293148) C2 calcium-dependent domain containing 3
chicken(419059) C2 calcium-dependent domain containing 3
domestic cat(101095369) C2 calcium-dependent domain containing 3
cow(768315) C2 calcium-dependent domain containing 3
cow(535235) C2 calcium-dependent domain containing 3
Horse(100065345) C2 calcium-dependent domain containing 3
dog(476808) C2 calcium-dependent domain containing 3
sheep(101105438) C2 calcium-dependent domain containing 3
Domestic Rabbit(100356772) C2 calcium-dependent domain containing 3
naked mole-rat(101712462) C2 calcium-dependent domain containing 3
domestic guinea pig(100726715) C2 calcium-dependent domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015531 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001017985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001017985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001017985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015531 Rosetta Predictions human pricing
XM_001066026 Rosetta Predictions rat pricing
XM_215006 Rosetta Predictions rat pricing
NM_001017985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217829 predicted 5195
2 SASI_Hs01_00217834 predicted 385
3 SASI_Hs02_00348042 predicted 503
4 SASI_Hs01_00217835 predicted 4209
5 SASI_Hs02_00348043 predicted 2829
6 SASI_Hs01_00217836 predicted 4567
7 SASI_Hs01_00217837 predicted 3717
8 SASI_Hs02_00348044 predicted 5885
9 SASI_Hs02_00348045 predicted 4533
10 SASI_Hs01_00217838 predicted 4518
11 SASI_Hs01_00217830 predicted 328
12 SASI_Hs01_00217831 predicted 4974
13 SASI_Hs01_00217832 predicted 1229
14 SASI_Hs01_00217833 predicted 3977
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316108 predicted 308
2 SASI_Rn02_00316109 predicted 3648
3 SASI_Rn02_00316110 predicted 4137
4 SASI_Rn02_00316111 predicted 621
5 SASI_Rn02_00316112 predicted 4091
6 SASI_Rn02_00316113 predicted 2544
7 SASI_Rn02_00316114 predicted 4717
8 SASI_Rn02_00316115 predicted 5157
9 SASI_Rn02_00316116 predicted 2981
10 SASI_Rn02_00316117 predicted 6716
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375737 predicted 311
2 SASI_Rn02_00375738 predicted 3648
3 SASI_Rn02_00375739 predicted 4134
4 SASI_Rn02_00375740 predicted 627
5 SASI_Rn02_00375741 predicted 4096
6 SASI_Rn02_00375742 predicted 2538
7 SASI_Rn02_00375743 predicted 5163
8 SASI_Rn02_00375744 predicted 470
9 SASI_Rn02_00375745 predicted 2985
10 SASI_Rn02_00375746 predicted 6714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060608 predicted 6792
2 SASI_Mm01_00060609 predicted 4469
3 SASI_Mm01_00060610 predicted 3947
4 SASI_Mm02_00287528 predicted 2073
5 SASI_Mm01_00060611 predicted 5992
6 SASI_Mm01_00060613 predicted 2021
7 SASI_Mm01_00060614 predicted 4275
8 SASI_Mm01_00060615 predicted 6326
9 SASI_Mm01_00060616 predicted 2947
10 SASI_Mm02_00287529 predicted 5288
11 SASI_Mm01_00060607 predicted 3408
12 SASI_Mm01_00060612 predicted 3243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015531
VALIDATED
C2CD3 MISSION shRNA Bacterial Glycerol Stock
C2 calcium-dependent domain containing 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015531.1-2247s1c1
Sequence:CCGGGCCTAAGGAATCTGTAAACAACTCGAGTTGTTTACAGATTCCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015531.1-2900s1c1
Sequence:CCGGCCGATGAGTCATCTCCTGTATCTCGAGATACAGGAGATGACTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015531.4-2311s21c1
Sequence:CCGGAGGTAACCATGGAGCTTATTACTCGAGTAATAAGCTCCATGGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015531.4-3561s21c1
Sequence:CCGGATCTGGTGCAGATACTATTATCTCGAGATAATAGTATCTGCACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015531.4-6121s21c1
Sequence:CCGGGTAACTGGAAGCATGAACATGCTCGAGCATGTTCATGCTTCCAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015531.4-2368s21c1
Sequence:CCGGTAAGTGGCAACACCCATTATACTCGAGTATAATGGGTGTTGCCACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_015531.4-2576s21c1
Sequence:CCGGTACGCCAGCCTCCCATAATTTCTCGAGAAATTATGGGAGGCTGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015531
VALIDATED
C2CD3 MISSION shRNA shRNA Plasmid DNA
C2 calcium-dependent domain containing 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015531.1-2247s1c1
Sequence:CCGGGCCTAAGGAATCTGTAAACAACTCGAGTTGTTTACAGATTCCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015531.1-2900s1c1
Sequence:CCGGCCGATGAGTCATCTCCTGTATCTCGAGATACAGGAGATGACTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015531.4-2311s21c1
Sequence:CCGGAGGTAACCATGGAGCTTATTACTCGAGTAATAAGCTCCATGGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015531.4-3561s21c1
Sequence:CCGGATCTGGTGCAGATACTATTATCTCGAGATAATAGTATCTGCACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015531.4-6121s21c1
Sequence:CCGGGTAACTGGAAGCATGAACATGCTCGAGCATGTTCATGCTTCCAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015531.4-2368s21c1
Sequence:CCGGTAAGTGGCAACACCCATTATACTCGAGTATAATGGGTGTTGCCACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_015531.4-2576s21c1
Sequence:CCGGTACGCCAGCCTCCCATAATTTCTCGAGAAATTATGGGAGGCTGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015531
VALIDATED
C2CD3 MISSION shRNA Lentiviral Transduction Particles
C2 calcium-dependent domain containing 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015531.1-2247s1c1
Sequence:CCGGGCCTAAGGAATCTGTAAACAACTCGAGTTGTTTACAGATTCCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015531.1-2900s1c1
Sequence:CCGGCCGATGAGTCATCTCCTGTATCTCGAGATACAGGAGATGACTCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015531.4-2311s21c1
Sequence:CCGGAGGTAACCATGGAGCTTATTACTCGAGTAATAAGCTCCATGGTTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015531.4-3561s21c1
Sequence:CCGGATCTGGTGCAGATACTATTATCTCGAGATAATAGTATCTGCACCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246008    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015531.4-6121s21c1
Sequence:CCGGGTAACTGGAAGCATGAACATGCTCGAGCATGTTCATGCTTCCAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_015531.4-2368s21c1
Sequence:CCGGTAAGTGGCAACACCCATTATACTCGAGTATAATGGGTGTTGCCACTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_015531.4-2576s21c1
Sequence:CCGGTACGCCAGCCTCCCATAATTTCTCGAGAAATTATGGGAGGCTGGCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017985
VALIDATED
C2CD3 MISSION shRNA Bacterial Glycerol Stock
C2 calcium-dependent domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-3496s21c1
Sequence:CCGGGTCTGGTGCAGATACTATTATCTCGAGATAATAGTATCTGCACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-1002s21c1
Sequence:CCGGGACGAATGTAGAGACTATAACCTCGAGGTTATAGTCTCTACATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-4651s21c1
Sequence:CCGGGCCTATGGCAACGACAATTTACTCGAGTAAATTGTCGTTGCCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-7126s21c1
Sequence:CCGGCGCAGGATTGCACGGATATTTCTCGAGAAATATCCGTGCAATCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-7261s21c1
Sequence:CCGGGGCCACTAGCATCACCCTATTCTCGAGAATAGGGTGATGCTAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017985
VALIDATED
C2CD3 MISSION shRNA shRNA Plasmid DNA
C2 calcium-dependent domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-3496s21c1
Sequence:CCGGGTCTGGTGCAGATACTATTATCTCGAGATAATAGTATCTGCACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-1002s21c1
Sequence:CCGGGACGAATGTAGAGACTATAACCTCGAGGTTATAGTCTCTACATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-4651s21c1
Sequence:CCGGGCCTATGGCAACGACAATTTACTCGAGTAAATTGTCGTTGCCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-7126s21c1
Sequence:CCGGCGCAGGATTGCACGGATATTTCTCGAGAAATATCCGTGCAATCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-7261s21c1
Sequence:CCGGGGCCACTAGCATCACCCTATTCTCGAGAATAGGGTGATGCTAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017985
VALIDATED
C2CD3 MISSION shRNA Lentiviral Transduction Particles
C2 calcium-dependent domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-3496s21c1
Sequence:CCGGGTCTGGTGCAGATACTATTATCTCGAGATAATAGTATCTGCACCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-1002s21c1
Sequence:CCGGGACGAATGTAGAGACTATAACCTCGAGGTTATAGTCTCTACATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-4651s21c1
Sequence:CCGGGCCTATGGCAACGACAATTTACTCGAGTAAATTGTCGTTGCCATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-7126s21c1
Sequence:CCGGCGCAGGATTGCACGGATATTTCTCGAGAAATATCCGTGCAATCCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258165    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001017985.2-7261s21c1
Sequence:CCGGGGCCACTAGCATCACCCTATTCTCGAGAATAGGGTGATGCTAGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks