EMAIL THIS PAGE TO A FRIEND

C2CD4A

C2 calcium-dependent domain containing 4A

Synonyms: FAM148A NLF1
UniProtKB ID: Q8NCU7
Gene ID:
Mouse(244911) C2 calcium-dependent domain containing 4A
Rat(691703) C2 calcium-dependent domain containing 4A
naked mole-rat(101717576) C2 calcium-dependent domain containing 4A
sheep(101102735) C2 calcium-dependent domain containing 4A
cow(529823) C2 calcium-dependent domain containing 4A
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301669 ANTI-FAM148A (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207322 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207322 Rosetta Predictions human pricing
XM_001079329 Rosetta Predictions rat pricing
XM_001004247 Rosetta Predictions mouse pricing
XM_001004252 Rosetta Predictions mouse pricing
XM_146937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373863 predicted 241
2 SASI_Hs01_00210381 predicted 260
3 SASI_Hs01_00210383 predicted 262
4 SASI_Hs02_00373864 predicted 235
5 SASI_Hs01_00210384 predicted 243
6 SASI_Hs01_00210385 predicted 266
7 SASI_Hs01_00210380 predicted 261
8 SASI_Hs02_00373865 predicted 1612
9 SASI_Hs02_00373866 predicted 1620
10 SASI_Hs02_00373867 predicted 1451
11 SASI_Hs01_00210379 predicted 218
12 SASI_Hs01_00210382 predicted 209
13 SASI_Hs01_00210386 predicted 231
14 SASI_Hs01_00210387 predicted 207
15 SASI_Hs01_00210388 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364016 predicted 946
2 SASI_Rn02_00364017 predicted 144
3 SASI_Rn02_00364018 predicted 288
4 SASI_Rn02_00364019 predicted 173
5 SASI_Rn02_00364020 predicted 1234
6 SASI_Rn02_00364021 predicted 1262
7 SASI_Rn02_00364022 predicted 1241
8 SASI_Rn02_00364023 predicted 69
9 SASI_Rn02_00364024 predicted 184
10 SASI_Rn02_00364025 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004247 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00356203 predicted 1051
2 SASI_Mm02_00356204 predicted 984
3 SASI_Mm02_00356205 predicted 897
4 SASI_Mm02_00356206 predicted 707
5 SASI_Mm02_00356207 predicted 979
6 SASI_Mm02_00356208 predicted 981
7 SASI_Mm02_00356209 predicted 195
8 SASI_Mm02_00356210 predicted 990
9 SASI_Mm02_00356211 predicted 928
10 SASI_Mm02_00356212 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00356213 predicted 986
2 SASI_Mm02_00356214 predicted 992
3 SASI_Mm02_00356215 predicted 905
4 SASI_Mm02_00356216 predicted 702
5 SASI_Mm02_00356217 predicted 982
6 SASI_Mm02_00356218 predicted 984
7 SASI_Mm02_00356219 predicted 193
8 SASI_Mm02_00356220 predicted 931
9 SASI_Mm02_00356221 predicted 978
10 SASI_Mm02_00356222 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425334 predicted 1098
2 SASI_Mm02_00425335 predicted 1105
3 SASI_Mm01_00235712 predicted 193
4 SASI_Mm02_00425336 predicted 1181
5 SASI_Mm02_00425337 predicted 1303
6 SASI_Mm02_00425338 predicted 1252
7 SASI_Mm02_00425339 predicted 136
8 SASI_Mm02_00425340 predicted 1128
9 SASI_Mm02_00425341 predicted 1302
10 SASI_Mm02_00425342 predicted 1244
11 SASI_Mm01_00235713 predicted 548
12 SASI_Mm01_00235714 predicted 441
13 SASI_Mm01_00235715 predicted 230
14 SASI_Mm01_00235716 predicted 589
15 SASI_Mm01_00235717 predicted 198
16 SASI_Mm01_00235718 predicted 427
17 SASI_Mm01_00235719 predicted 535
18 SASI_Mm01_00235720 predicted 443
19 SASI_Mm01_00235721 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207322
C2CD4A MISSION shRNA Bacterial Glycerol Stock
C2 calcium-dependent domain containing 4A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-1372s21c1
Sequence:CCGGGATGATTCTAGATTAACTATCCTCGAGGATAGTTAATCTAGAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-2270s21c1
Sequence:CCGGTTACTCTTATGTAGGTAATACCTCGAGGTATTACCTACATAAGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-3125s21c1
Sequence:CCGGCAGTCACAAATTAGGGTTATTCTCGAGAATAACCCTAATTTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-1741s21c1
Sequence:CCGGCCTGATACTCCTAGCTATATCCTCGAGGATATAGCTAGGAGTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-2297s21c1
Sequence:CCGGGTCTAAAGGGCTCGCTATTAACTCGAGTTAATAGCGAGCCCTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207322
C2CD4A MISSION shRNA shRNA Plasmid DNA
C2 calcium-dependent domain containing 4A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-1372s21c1
Sequence:CCGGGATGATTCTAGATTAACTATCCTCGAGGATAGTTAATCTAGAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-2270s21c1
Sequence:CCGGTTACTCTTATGTAGGTAATACCTCGAGGTATTACCTACATAAGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-3125s21c1
Sequence:CCGGCAGTCACAAATTAGGGTTATTCTCGAGAATAACCCTAATTTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-1741s21c1
Sequence:CCGGCCTGATACTCCTAGCTATATCCTCGAGGATATAGCTAGGAGTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-2297s21c1
Sequence:CCGGGTCTAAAGGGCTCGCTATTAACTCGAGTTAATAGCGAGCCCTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207322
C2CD4A MISSION shRNA Lentiviral Transduction Particles
C2 calcium-dependent domain containing 4A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-1372s21c1
Sequence:CCGGGATGATTCTAGATTAACTATCCTCGAGGATAGTTAATCTAGAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-2270s21c1
Sequence:CCGGTTACTCTTATGTAGGTAATACCTCGAGGTATTACCTACATAAGAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-3125s21c1
Sequence:CCGGCAGTCACAAATTAGGGTTATTCTCGAGAATAACCCTAATTTGTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-1741s21c1
Sequence:CCGGCCTGATACTCCTAGCTATATCCTCGAGGATATAGCTAGGAGTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207322.2-2297s21c1
Sequence:CCGGGTCTAAAGGGCTCGCTATTAACTCGAGTTAATAGCGAGCCCTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks