EMAIL THIS PAGE TO A FRIEND

C2CD4B

C2 calcium-dependent domain containing 4B

76 Gene Product Result for
Synonyms: FAM148B NLF2
UniProtKB ID: A6NLJ0
Gene ID:
Mouse(75697) C2 calcium-dependent domain containing 4B
Rat(501015) C2 calcium-dependent domain containing 4B
dog(478330) C2 calcium-dependent domain containing 4B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_370868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370868 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007595 Rosetta Predictions human pricing
XM_001056441 Rosetta Predictions rat pricing
XM_576426 Rosetta Predictions rat pricing
NM_001081314 Rosetta Predictions mouse pricing
XM_891872 Rosetta Predictions mouse pricing
XM_989017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305351 predicted 1272
2 SASI_Hs02_00305352 predicted 1284
3 SASI_Hs02_00305353 predicted 1277
4 SASI_Hs02_00305354 predicted 1310
5 SASI_Hs02_00305355 predicted 1284
6 SASI_Hs02_00305356 predicted 1279
7 SASI_Hs02_00305357 predicted 1311
8 SASI_Hs02_00305358 predicted 1251
9 SASI_Hs02_00305359 predicted 1284
10 SASI_Hs02_00305360 predicted 1356
11 SASI_Hs01_00044565 predicted 182
12 SASI_Hs01_00044566 predicted 131
13 SASI_Hs01_00044567 predicted 138
14 SASI_Hs01_00044568 predicted 176
15 SASI_Hs01_00044569 predicted 302
16 SASI_Hs01_00044570 predicted 200
17 SASI_Hs01_00044571 predicted 198
18 SASI_Hs01_00044572 predicted 883
19 SASI_Hs01_00044573 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283288 predicted 397
2 SASI_Rn02_00283289 predicted 527
3 SASI_Rn02_00283290 predicted 295
4 SASI_Rn02_00283291 predicted 621
5 SASI_Rn02_00283292 predicted 296
6 SASI_Rn02_00283293 predicted 244
7 SASI_Rn02_00283294 predicted 396
8 SASI_Rn02_00283295 predicted 531
9 SASI_Rn02_00283296 predicted 299
10 SASI_Rn02_00283297 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405300 predicted 868
2 SASI_Rn02_00405301 predicted 1196
3 SASI_Rn02_00405302 predicted 1166
4 SASI_Rn02_00405303 predicted 296
5 SASI_Rn02_00405304 predicted 1270
6 SASI_Rn02_00405305 predicted 1193
7 SASI_Rn02_00405306 predicted 1194
8 SASI_Rn02_00405307 predicted 1190
9 SASI_Rn02_00405308 predicted 294
10 SASI_Rn02_00405309 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297201 predicted 1157
2 SASI_Mm02_00297202 predicted 1434
3 SASI_Mm02_00297203 predicted 1212
4 SASI_Mm02_00297204 predicted 1209
5 SASI_Mm02_00297205 predicted 1474
6 SASI_Mm02_00297206 predicted 1342
7 SASI_Mm02_00297207 predicted 1338
8 SASI_Mm02_00297208 predicted 1427
9 SASI_Mm02_00297209 predicted 1178
10 SASI_Mm02_00297210 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285507 predicted 1341
2 SASI_Mm01_00285508 predicted 1351
3 SASI_Mm01_00285509 predicted 1368
4 SASI_Mm01_00285510 predicted 2221
5 SASI_Mm01_00285511 predicted 2205
6 SASI_Mm01_00285512 predicted 2235
7 SASI_Mm01_00285513 predicted 2277
8 SASI_Mm01_00285514 predicted 2255
9 SASI_Mm01_00285515 predicted 2244
10 SASI_Mm01_00285516 predicted 2225
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_989017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285836 predicted 757
2 SASI_Mm01_00285837 predicted 758
3 SASI_Mm01_00285838 predicted 788
4 SASI_Mm01_00285839 predicted 694
5 SASI_Mm01_00285840 predicted 1636
6 SASI_Mm01_00285841 predicted 1620
7 SASI_Mm01_00285842 predicted 1640
8 SASI_Mm01_00285843 predicted 1690
9 SASI_Mm01_00285844 predicted 1664
10 SASI_Mm01_00285845 predicted 1652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081314
C2CD4B MISSION shRNA Bacterial Glycerol Stock
C2 calcium-dependent domain containing 4B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081314.1-1348s21c1
Sequence:CCGGGCGAAGACAGTGACGAAGACTCTCGAGAGTCTTCGTCACTGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081314.1-2182s21c1
Sequence:CCGGCCTGGTGCTCTGGACATTTAACTCGAGTTAAATGTCCAGAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081314.1-2023s21c1
Sequence:CCGGACCAGGACTGCTGCTTCGATCCTCGAGGATCGAAGCAGCAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081314.1-1189s21c1
Sequence:CCGGCTGCCTTCTCCAACGTGCTCACTCGAGTGAGCACGTTGGAGAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081314.1-2149s21c1
Sequence:CCGGTGGGCTCTCTGCTACTGCTATCTCGAGATAGCAGTAGCAGAGAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081314
C2CD4B MISSION shRNA shRNA Plasmid DNA
C2 calcium-dependent domain containing 4B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081314.1-1348s21c1
Sequence:CCGGGCGAAGACAGTGACGAAGACTCTCGAGAGTCTTCGTCACTGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081314.1-2182s21c1
Sequence:CCGGCCTGGTGCTCTGGACATTTAACTCGAGTTAAATGTCCAGAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081314.1-2023s21c1
Sequence:CCGGACCAGGACTGCTGCTTCGATCCTCGAGGATCGAAGCAGCAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081314.1-1189s21c1
Sequence:CCGGCTGCCTTCTCCAACGTGCTCACTCGAGTGAGCACGTTGGAGAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081314.1-2149s21c1
Sequence:CCGGTGGGCTCTCTGCTACTGCTATCTCGAGATAGCAGTAGCAGAGAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081314
C2CD4B MISSION shRNA Lentiviral Transduction Particles
C2 calcium-dependent domain containing 4B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081314.1-1348s21c1
Sequence:CCGGGCGAAGACAGTGACGAAGACTCTCGAGAGTCTTCGTCACTGTCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081314.1-2182s21c1
Sequence:CCGGCCTGGTGCTCTGGACATTTAACTCGAGTTAAATGTCCAGAGCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081314.1-2023s21c1
Sequence:CCGGACCAGGACTGCTGCTTCGATCCTCGAGGATCGAAGCAGCAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081314.1-1189s21c1
Sequence:CCGGCTGCCTTCTCCAACGTGCTCACTCGAGTGAGCACGTTGGAGAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081314.1-2149s21c1
Sequence:CCGGTGGGCTCTCTGCTACTGCTATCTCGAGATAGCAGTAGCAGAGAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370868
C2CD4B MISSION shRNA Bacterial Glycerol Stock
C2 calcium-dependent domain containing 4B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000187465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370868.1-1431s1c1
Sequence:CCGGGCGTGGTACAGAATAAACGTTCTCGAGAACGTTTATTCTGTACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370868.1-1470s1c1
Sequence:CCGGGATACTGCTTTATTGACGTTTCTCGAGAAACGTCAATAAAGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370868.1-1518s1c1
Sequence:CCGGCGTCTATTGGTAAAGAAGAAACTCGAGTTTCTTCTTTACCAATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187000    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370868.1-1432s1c1
Sequence:CCGGCGTGGTACAGAATAAACGTTACTCGAGTAACGTTTATTCTGTACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370868
C2CD4B MISSION shRNA shRNA Plasmid DNA
C2 calcium-dependent domain containing 4B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000187465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370868.1-1431s1c1
Sequence:CCGGGCGTGGTACAGAATAAACGTTCTCGAGAACGTTTATTCTGTACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370868.1-1470s1c1
Sequence:CCGGGATACTGCTTTATTGACGTTTCTCGAGAAACGTCAATAAAGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370868.1-1518s1c1
Sequence:CCGGCGTCTATTGGTAAAGAAGAAACTCGAGTTTCTTCTTTACCAATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187000    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370868.1-1432s1c1
Sequence:CCGGCGTGGTACAGAATAAACGTTACTCGAGTAACGTTTATTCTGTACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370868
C2CD4B MISSION shRNA Lentiviral Transduction Particles
C2 calcium-dependent domain containing 4B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000187465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370868.1-1431s1c1
Sequence:CCGGGCGTGGTACAGAATAAACGTTCTCGAGAACGTTTATTCTGTACCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185628    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370868.1-1470s1c1
Sequence:CCGGGATACTGCTTTATTGACGTTTCTCGAGAAACGTCAATAAAGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370868.1-1518s1c1
Sequence:CCGGCGTCTATTGGTAAAGAAGAAACTCGAGTTTCTTCTTTACCAATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187000    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_370868.1-1432s1c1
Sequence:CCGGCGTGGTACAGAATAAACGTTACTCGAGTAACGTTTATTCTGTACCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks