EMAIL THIS PAGE TO A FRIEND

C2CD4C

C2 calcium-dependent domain containing 4C

63 Gene Product Result for
Synonyms: FAM148C KIAA1957 NLF3
UniProtKB ID: Q8TF44, Q8N3H7
Gene ID:
Mouse(237397) C2 calcium-dependent domain containing 4C
Rat(500798) C2 calcium-dependent domain containing 4C
domestic guinea pig(100735415) C2 calcium-dependent domain containing 4C
naked mole-rat(101724289) C2 calcium-dependent domain containing 4C
sheep(101107443) C2 calcium-dependent domain containing 4C
chicken(428334) C2 calcium-dependent domain containing 4C
cow(519630) C2 calcium-dependent domain containing 4C
dog(485104) C2 calcium-dependent domain containing 4C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001136263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136263 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001718840 Rosetta Predictions human pricing
XM_065166 Rosetta Predictions human pricing
XM_939576 Rosetta Predictions human pricing
NM_001109285 Rosetta Predictions rat pricing
NM_198614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00426649 predicted 707
2 SASI_Hs02_00426650 predicted 258
3 SASI_Hs02_00426651 predicted 914
4 SASI_Hs02_00426652 predicted 1290
5 SASI_Hs02_00426653 predicted 2158
6 SASI_Hs02_00426654 predicted 2031
7 SASI_Hs02_00426655 predicted 1761
8 SASI_Hs02_00426656 predicted 2168
9 SASI_Hs02_00426657 predicted 2172
10 SASI_Hs02_00426658 predicted 2032
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_065166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254173 predicted 693
2 SASI_Hs02_00478750 predicted 256
3 SASI_Hs01_00254175 predicted 894
4 SASI_Hs02_00478751 predicted 1011
5 SASI_Hs01_00254176 predicted 2143
6 SASI_Hs01_00254177 predicted 2012
7 SASI_Hs01_00254178 predicted 1741
8 SASI_Hs01_00254179 predicted 2156
9 SASI_Hs02_00478752 predicted 2151
10 SASI_Hs01_00254180 predicted 2014
11 SASI_Hs01_00254174 predicted 1116
12 SASI_Hs01_00254181 predicted 158
13 SASI_Hs01_00254182 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939576 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483699 predicted 692
2 SASI_Hs02_00483700 predicted 253
3 SASI_Hs02_00483701 predicted 896
4 SASI_Hs02_00483702 predicted 1276
5 SASI_Hs02_00483703 predicted 2145
6 SASI_Hs02_00483704 predicted 2017
7 SASI_Hs02_00483705 predicted 1739
8 SASI_Hs02_00483706 predicted 2153
9 SASI_Hs02_00483707 predicted 2154
10 SASI_Hs02_00483708 predicted 2016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246914 predicted 649
2 SASI_Rn02_00246915 predicted 1153
3 SASI_Rn02_00246916 predicted 420
4 SASI_Rn02_00246917 predicted 1112
5 SASI_Rn02_00246918 predicted 750
6 SASI_Rn02_00246919 predicted 1066
7 SASI_Rn02_00246920 predicted 1338
8 SASI_Rn02_00246921 predicted 333
9 SASI_Rn02_00246922 predicted 423
10 SASI_Rn02_00246923 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157807 predicted 579
2 SASI_Mm01_00157808 predicted 375
3 SASI_Mm02_00351036 predicted 533
4 SASI_Mm01_00157809 predicted 1096
5 SASI_Mm01_00157810 predicted 1266
6 SASI_Mm01_00157811 predicted 1053
7 SASI_Mm01_00157812 predicted 687
8 SASI_Mm01_00157813 predicted 1425
9 SASI_Mm01_00157814 predicted 283
10 SASI_Mm01_00157815 predicted 1502
11 SASI_Mm01_00157816 predicted 1534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198614
C2CD4C MISSION shRNA Bacterial Glycerol Stock
C2 calcium-dependent domain containing 4C
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000195903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198614.1-1343s1c1
Sequence:CCGGCAATAAGGGTAGCAGCCTCAACTCGAGTTGAGGCTGCTACCCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198614.1-585s1c1
Sequence:CCGGGCTCAGACATCCTATGGCTTTCTCGAGAAAGCCATAGGATGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198614.1-579s1c1
Sequence:CCGGCACAAGGCTCAGACATCCTATCTCGAGATAGGATGTCTGAGCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198614.1-262s1c1
Sequence:CCGGCCTTGTATAGCAACGTGCTGACTCGAGTCAGCACGTTGCTATACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198614
C2CD4C MISSION shRNA shRNA Plasmid DNA
C2 calcium-dependent domain containing 4C
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000195903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198614.1-1343s1c1
Sequence:CCGGCAATAAGGGTAGCAGCCTCAACTCGAGTTGAGGCTGCTACCCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198614.1-585s1c1
Sequence:CCGGGCTCAGACATCCTATGGCTTTCTCGAGAAAGCCATAGGATGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198614.1-579s1c1
Sequence:CCGGCACAAGGCTCAGACATCCTATCTCGAGATAGGATGTCTGAGCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198614.1-262s1c1
Sequence:CCGGCCTTGTATAGCAACGTGCTGACTCGAGTCAGCACGTTGCTATACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198614
C2CD4C MISSION shRNA Lentiviral Transduction Particles
C2 calcium-dependent domain containing 4C
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000195903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198614.1-1343s1c1
Sequence:CCGGCAATAAGGGTAGCAGCCTCAACTCGAGTTGAGGCTGCTACCCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198614.1-585s1c1
Sequence:CCGGGCTCAGACATCCTATGGCTTTCTCGAGAAAGCCATAGGATGTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198614.1-579s1c1
Sequence:CCGGCACAAGGCTCAGACATCCTATCTCGAGATAGGATGTCTGAGCCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198614.1-262s1c1
Sequence:CCGGCCTTGTATAGCAACGTGCTGACTCGAGTCAGCACGTTGCTATACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136263
C2CD4C MISSION shRNA Bacterial Glycerol Stock
C2 calcium-dependent domain containing 4C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-911s21c1
Sequence:CCGGGTGTCTCTGCTCAAAGGTTTCCTCGAGGAAACCTTTGAGCAGAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-533s21c1
Sequence:CCGGCACGTGATCCAGATCGAGAGTCTCGAGACTCTCGATCTGGATCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-1377s21c1
Sequence:CCGGGGATCAAGGTGGTGAACAAGGCTCGAGCCTTGTTCACCACCTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-690s21c1
Sequence:CCGGAGGAGTCTCTGTTCCACAGTGCTCGAGCACTGTGGAACAGAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-322s21c1
Sequence:CCGGCAATGTGTTGACGCCCGACAACTCGAGTTGTCGGGCGTCAACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136263
C2CD4C MISSION shRNA shRNA Plasmid DNA
C2 calcium-dependent domain containing 4C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-911s21c1
Sequence:CCGGGTGTCTCTGCTCAAAGGTTTCCTCGAGGAAACCTTTGAGCAGAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-533s21c1
Sequence:CCGGCACGTGATCCAGATCGAGAGTCTCGAGACTCTCGATCTGGATCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-1377s21c1
Sequence:CCGGGGATCAAGGTGGTGAACAAGGCTCGAGCCTTGTTCACCACCTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-690s21c1
Sequence:CCGGAGGAGTCTCTGTTCCACAGTGCTCGAGCACTGTGGAACAGAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-322s21c1
Sequence:CCGGCAATGTGTTGACGCCCGACAACTCGAGTTGTCGGGCGTCAACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136263
C2CD4C MISSION shRNA Lentiviral Transduction Particles
C2 calcium-dependent domain containing 4C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-911s21c1
Sequence:CCGGGTGTCTCTGCTCAAAGGTTTCCTCGAGGAAACCTTTGAGCAGAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-533s21c1
Sequence:CCGGCACGTGATCCAGATCGAGAGTCTCGAGACTCTCGATCTGGATCACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-1377s21c1
Sequence:CCGGGGATCAAGGTGGTGAACAAGGCTCGAGCCTTGTTCACCACCTTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-690s21c1
Sequence:CCGGAGGAGTCTCTGTTCCACAGTGCTCGAGCACTGTGGAACAGAGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136263.1-322s21c1
Sequence:CCGGCAATGTGTTGACGCCCGACAACTCGAGTTGTCGGGCGTCAACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks