EMAIL THIS PAGE TO A FRIEND

C2CD4D

C2 calcium-dependent domain containing 4D

Synonyms: FAM148D
UniProtKB ID: B7Z1M9, B2RXG8
Gene ID:
Mouse(271944) C2 calcium-dependent domain containing 4D
Rat(100363111) C2 calcium-dependent domain containing 4D
domestic cat(101084559) C2 calcium-dependent domain containing 4D
cow(787419) C2 calcium-dependent domain containing 4D
sheep(101119360) C2 calcium-dependent domain containing 4D
naked mole-rat(101702220) C2 calcium-dependent domain containing 4D
domestic guinea pig(100720390) C2 calcium-dependent domain containing 4D
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136117 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001136117 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001136117 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001001226 Rosetta Predictions mouse pricing
XM_195466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214696 predicted 975
2 SASI_Mm01_00214698 predicted 977
3 SASI_Mm01_00214701 predicted 628
4 SASI_Mm02_00355037 predicted 954
5 SASI_Mm01_00214702 predicted 933
6 SASI_Mm01_00214703 predicted 797
7 SASI_Mm01_00214705 predicted 660
8 SASI_Mm02_00355038 predicted 979
9 SASI_Mm02_00355039 predicted 929
10 SASI_Mm02_00355040 predicted 985
11 SASI_Mm01_00214697 predicted 475
12 SASI_Mm01_00214699 predicted 279
13 SASI_Mm01_00214700 predicted 271
14 SASI_Mm01_00214704 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_195466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425482 predicted 468
2 SASI_Mm02_00425483 predicted 914
3 SASI_Mm02_00425484 predicted 915
4 SASI_Mm02_00425485 predicted 864
5 SASI_Mm02_00425486 predicted 278
6 SASI_Mm02_00425487 predicted 314
7 SASI_Mm02_00425488 predicted 306
8 SASI_Mm02_00425489 predicted 308
9 SASI_Mm02_00425490 predicted 280
10 SASI_Mm02_00425491 predicted 627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136117
C2CD4D MISSION shRNA Bacterial Glycerol Stock
C2 calcium-dependent domain containing 4D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-282s21c1
Sequence:CCGGCTCGCGCTGCAACCCTAATGTCTCGAGACATTAGGGTTGCAGCGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-317s21c1
Sequence:CCGGGCATCCCACAGTTCTTCATACCTCGAGGTATGAAGAACTGTGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-978s21c1
Sequence:CCGGGAGCAGCTGCAACCCTATCTTCTCGAGAAGATAGGGTTGCAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-732s21c1
Sequence:CCGGGGACTTCCTCTGCTGCCAACTCTCGAGAGTTGGCAGCAGAGGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-717s21c1
Sequence:CCGGACCGCTCTTCCACCTGGACTTCTCGAGAAGTCCAGGTGGAAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136117
C2CD4D MISSION shRNA shRNA Plasmid DNA
C2 calcium-dependent domain containing 4D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-282s21c1
Sequence:CCGGCTCGCGCTGCAACCCTAATGTCTCGAGACATTAGGGTTGCAGCGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-317s21c1
Sequence:CCGGGCATCCCACAGTTCTTCATACCTCGAGGTATGAAGAACTGTGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-978s21c1
Sequence:CCGGGAGCAGCTGCAACCCTATCTTCTCGAGAAGATAGGGTTGCAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-732s21c1
Sequence:CCGGGGACTTCCTCTGCTGCCAACTCTCGAGAGTTGGCAGCAGAGGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-717s21c1
Sequence:CCGGACCGCTCTTCCACCTGGACTTCTCGAGAAGTCCAGGTGGAAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136117
C2CD4D MISSION shRNA Lentiviral Transduction Particles
C2 calcium-dependent domain containing 4D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-282s21c1
Sequence:CCGGCTCGCGCTGCAACCCTAATGTCTCGAGACATTAGGGTTGCAGCGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-317s21c1
Sequence:CCGGGCATCCCACAGTTCTTCATACCTCGAGGTATGAAGAACTGTGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-978s21c1
Sequence:CCGGGAGCAGCTGCAACCCTATCTTCTCGAGAAGATAGGGTTGCAGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-732s21c1
Sequence:CCGGGGACTTCCTCTGCTGCCAACTCTCGAGAGTTGGCAGCAGAGGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136117.1-717s21c1
Sequence:CCGGACCGCTCTTCCACCTGGACTTCTCGAGAAGTCCAGGTGGAAGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks