EMAIL THIS PAGE TO A FRIEND

C2CD5

C2 calcium-dependent domain containing 5

Synonyms: CDP138 KIAA0528
UniProtKB ID: Q86YS7, O60280, Q17RY7, Q7Z619, Q86SU3
Gene ID:
Mouse(74741) C2 calcium-dependent domain containing 5
Rat(362461) C2 calcium-dependent domain containing 5
domestic guinea pig(100721333) C2 calcium-dependent domain containing 5
naked mole-rat(101724525) C2 calcium-dependent domain containing 5
Zebrafish(393585) C2 calcium-dependent domain containing 5
cow(520387) C2 calcium-dependent domain containing 5
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA046194 Anti-C2CD5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014802 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014802 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014802 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014802 Rosetta Predictions human pricing
NM_001134581 Rosetta Predictions rat pricing
NM_001109688 Rosetta Predictions mouse pricing
NM_029081 Rosetta Predictions mouse pricing
NM_029897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014802 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242718 predicted 836
2 SASI_Hs01_00242719 predicted 496
3 SASI_Hs01_00242720 predicted 2798
4 SASI_Hs01_00242722 predicted 2177
5 SASI_Hs02_00346315 predicted 450
6 SASI_Hs01_00242723 predicted 413
7 SASI_Hs01_00242724 predicted 881
8 SASI_Hs01_00242725 predicted 1755
9 SASI_Hs01_00242726 predicted 2459
10 SASI_Hs02_00346316 predicted 2501
11 SASI_Hs01_00242721 predicted 558
12 SASI_Hs01_00242727 predicted 3292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134581 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257299 predicted 2366
2 SASI_Rn02_00257300 predicted 1009
3 SASI_Rn02_00257301 predicted 732
4 SASI_Rn02_00257302 predicted 3343
5 SASI_Rn02_00257303 predicted 2737
6 SASI_Rn02_00257304 predicted 573
7 SASI_Rn02_00257305 predicted 2768
8 SASI_Rn02_00257306 predicted 535
9 SASI_Rn02_00257307 predicted 1656
10 SASI_Rn02_00257308 predicted 3358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304164 predicted 2373
2 SASI_Mm02_00304165 predicted 3094
3 SASI_Mm02_00304166 predicted 1717
4 SASI_Mm02_00304167 predicted 382
5 SASI_Mm02_00304168 predicted 1704
6 SASI_Mm02_00304169 predicted 321
7 SASI_Mm02_00304170 predicted 1606
8 SASI_Mm02_00304171 predicted 451
9 SASI_Mm02_00304172 predicted 2356
10 SASI_Mm02_00304173 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153089 predicted 2391
2 SASI_Mm01_00153090 predicted 3176
3 SASI_Mm01_00153091 predicted 1743
4 SASI_Mm02_00334842 predicted 385
5 SASI_Mm01_00153092 predicted 1739
6 SASI_Mm02_00334843 predicted 318
7 SASI_Mm01_00153095 predicted 1628
8 SASI_Mm02_00334844 predicted 452
9 SASI_Mm01_00153096 predicted 2382
10 SASI_Mm02_00334845 predicted 532
11 SASI_Mm01_00153093 predicted 3107
12 SASI_Mm01_00153094 predicted 1409
13 SASI_Mm01_00153097 predicted 642
14 SASI_Mm01_00153098 predicted 3119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336152 predicted 2391
2 SASI_Mm02_00336153 predicted 3126
3 SASI_Mm02_00336154 predicted 1749
4 SASI_Mm02_00336155 predicted 385
5 SASI_Mm02_00336156 predicted 1739
6 SASI_Mm02_00336157 predicted 321
7 SASI_Mm02_00336158 predicted 1635
8 SASI_Mm02_00336159 predicted 450
9 SASI_Mm02_00336160 predicted 2382
10 SASI_Mm02_00336161 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014802
VALIDATED
C2CD5 MISSION shRNA Bacterial Glycerol Stock
C2 calcium-dependent domain containing 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014802.1-456s21c1
Sequence:CCGGCCATGATACTTACAGTGCAAACTCGAGTTTGCACTGTAAGTATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014802.1-2439s21c1
Sequence:CCGGCCTGACTAATCAAGCTCTCAACTCGAGTTGAGAGCTTGATTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014802.1-2531s21c1
Sequence:CCGGGCTGCCTTTGCCATGTAAATTCTCGAGAATTTACATGGCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014802.1-3725s21c1
Sequence:CCGGCGGTAACAACTGAAAGGGAAACTCGAGTTTCCCTTTCAGTTGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014802.1-1732s21c1
Sequence:CCGGCCAACAGATGCAACAGTTATTCTCGAGAATAACTGTTGCATCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014802.1-2531s1c1
Sequence:CCGGGCTGCCTTTGCCATGTAAATTCTCGAGAATTTACATGGCAAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014802.1-2439s1c1
Sequence:CCGGCCTGACTAATCAAGCTCTCAACTCGAGTTGAGAGCTTGATTAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014802.1-3481s1c1
Sequence:CCGGGCAAAGATGGAACCTTTGTAACTCGAGTTACAAAGGTTCCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014802.1-2440s1c1
Sequence:CCGGCTGACTAATCAAGCTCTCAATCTCGAGATTGAGAGCTTGATTAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014802.1-4217s1c1
Sequence:CCGGGCCCGTTGTAAATGAACCTTACTCGAGTAAGGTTCATTTACAACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014802.1-1732s1c1
Sequence:CCGGCCAACAGATGCAACAGTTATTCTCGAGAATAACTGTTGCATCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014802.1-456s1c1
Sequence:CCGGCCATGATACTTACAGTGCAAACTCGAGTTTGCACTGTAAGTATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014802.1-3725s1c1
Sequence:CCGGCGGTAACAACTGAAAGGGAAACTCGAGTTTCCCTTTCAGTTGTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014802
VALIDATED
C2CD5 MISSION shRNA shRNA Plasmid DNA
C2 calcium-dependent domain containing 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014802.1-456s21c1
Sequence:CCGGCCATGATACTTACAGTGCAAACTCGAGTTTGCACTGTAAGTATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014802.1-2439s21c1
Sequence:CCGGCCTGACTAATCAAGCTCTCAACTCGAGTTGAGAGCTTGATTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014802.1-2531s21c1
Sequence:CCGGGCTGCCTTTGCCATGTAAATTCTCGAGAATTTACATGGCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014802.1-3725s21c1
Sequence:CCGGCGGTAACAACTGAAAGGGAAACTCGAGTTTCCCTTTCAGTTGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014802.1-1732s21c1
Sequence:CCGGCCAACAGATGCAACAGTTATTCTCGAGAATAACTGTTGCATCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014802.1-2531s1c1
Sequence:CCGGGCTGCCTTTGCCATGTAAATTCTCGAGAATTTACATGGCAAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014802.1-2439s1c1
Sequence:CCGGCCTGACTAATCAAGCTCTCAACTCGAGTTGAGAGCTTGATTAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014802.1-3481s1c1
Sequence:CCGGGCAAAGATGGAACCTTTGTAACTCGAGTTACAAAGGTTCCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014802.1-2440s1c1
Sequence:CCGGCTGACTAATCAAGCTCTCAATCTCGAGATTGAGAGCTTGATTAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014802.1-4217s1c1
Sequence:CCGGGCCCGTTGTAAATGAACCTTACTCGAGTAAGGTTCATTTACAACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014802.1-1732s1c1
Sequence:CCGGCCAACAGATGCAACAGTTATTCTCGAGAATAACTGTTGCATCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014802.1-456s1c1
Sequence:CCGGCCATGATACTTACAGTGCAAACTCGAGTTTGCACTGTAAGTATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014802.1-3725s1c1
Sequence:CCGGCGGTAACAACTGAAAGGGAAACTCGAGTTTCCCTTTCAGTTGTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014802
VALIDATED
C2CD5 MISSION shRNA Lentiviral Transduction Particles
C2 calcium-dependent domain containing 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014802.1-456s21c1
Sequence:CCGGCCATGATACTTACAGTGCAAACTCGAGTTTGCACTGTAAGTATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014802.1-2439s21c1
Sequence:CCGGCCTGACTAATCAAGCTCTCAACTCGAGTTGAGAGCTTGATTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014802.1-2531s21c1
Sequence:CCGGGCTGCCTTTGCCATGTAAATTCTCGAGAATTTACATGGCAAAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014802.1-3725s21c1
Sequence:CCGGCGGTAACAACTGAAAGGGAAACTCGAGTTTCCCTTTCAGTTGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014802.1-1732s21c1
Sequence:CCGGCCAACAGATGCAACAGTTATTCTCGAGAATAACTGTTGCATCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014802.1-2531s1c1
Sequence:CCGGGCTGCCTTTGCCATGTAAATTCTCGAGAATTTACATGGCAAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014802.1-2439s1c1
Sequence:CCGGCCTGACTAATCAAGCTCTCAACTCGAGTTGAGAGCTTGATTAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130031    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014802.1-3481s1c1
Sequence:CCGGGCAAAGATGGAACCTTTGTAACTCGAGTTACAAAGGTTCCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014802.1-2440s1c1
Sequence:CCGGCTGACTAATCAAGCTCTCAATCTCGAGATTGAGAGCTTGATTAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149885    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014802.1-4217s1c1
Sequence:CCGGGCCCGTTGTAAATGAACCTTACTCGAGTAAGGTTCATTTACAACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014802.1-1732s1c1
Sequence:CCGGCCAACAGATGCAACAGTTATTCTCGAGAATAACTGTTGCATCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_014802.1-456s1c1
Sequence:CCGGCCATGATACTTACAGTGCAAACTCGAGTTTGCACTGTAAGTATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148548    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014802.1-3725s1c1
Sequence:CCGGCGGTAACAACTGAAAGGGAAACTCGAGTTTCCCTTTCAGTTGTTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029081
VALIDATED
C2CD5 MISSION shRNA Bacterial Glycerol Stock
C2 calcium-dependent domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029081.1-683s1c1
Sequence:CCGGGTTGGTTACTTGCAGTGCTTTCTCGAGAAAGCACTGCAAGTAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029081.1-2162s1c1
Sequence:CCGGCCTGGCATAAATAACTGGACACTCGAGTGTCCAGTTATTTATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029081.1-1202s1c1
Sequence:CCGGGCAGAAATCAGACAAGAGATACTCGAGTATCTCTTGTCTGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029081.1-3852s1c1
Sequence:CCGGGCACTCAATAATCTTAGGGATCTCGAGATCCCTAAGATTATTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029081.1-3438s1c1
Sequence:CCGGGCTGATTTGTAAATGGAGGAACTCGAGTTCCTCCATTTACAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029081
VALIDATED
C2CD5 MISSION shRNA shRNA Plasmid DNA
C2 calcium-dependent domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029081.1-683s1c1
Sequence:CCGGGTTGGTTACTTGCAGTGCTTTCTCGAGAAAGCACTGCAAGTAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029081.1-2162s1c1
Sequence:CCGGCCTGGCATAAATAACTGGACACTCGAGTGTCCAGTTATTTATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029081.1-1202s1c1
Sequence:CCGGGCAGAAATCAGACAAGAGATACTCGAGTATCTCTTGTCTGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029081.1-3852s1c1
Sequence:CCGGGCACTCAATAATCTTAGGGATCTCGAGATCCCTAAGATTATTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029081.1-3438s1c1
Sequence:CCGGGCTGATTTGTAAATGGAGGAACTCGAGTTCCTCCATTTACAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029081
VALIDATED
C2CD5 MISSION shRNA Lentiviral Transduction Particles
C2 calcium-dependent domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029081.1-683s1c1
Sequence:CCGGGTTGGTTACTTGCAGTGCTTTCTCGAGAAAGCACTGCAAGTAACCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029081.1-2162s1c1
Sequence:CCGGCCTGGCATAAATAACTGGACACTCGAGTGTCCAGTTATTTATGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029081.1-1202s1c1
Sequence:CCGGGCAGAAATCAGACAAGAGATACTCGAGTATCTCTTGTCTGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029081.1-3852s1c1
Sequence:CCGGGCACTCAATAATCTTAGGGATCTCGAGATCCCTAAGATTATTGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029081.1-3438s1c1
Sequence:CCGGGCTGATTTGTAAATGGAGGAACTCGAGTTCCTCCATTTACAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks