EMAIL THIS PAGE TO A FRIEND

C2orf15

chromosome 2 open reading frame 15

41 Gene Product Result for
Species: Human C2orf15(150590)
UniProtKB ID: Q8WU43
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042990 Anti-C2orf15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144706 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050341 MISSION® esiRNA esiRNA human C2orf15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144706 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043819 predicted 832
2 SASI_Hs01_00043820 predicted 895
3 SASI_Hs01_00043821 predicted 782
4 SASI_Hs01_00043822 predicted 563
5 SASI_Hs01_00043823 predicted 784
6 SASI_Hs01_00043824 predicted 694
7 SASI_Hs01_00043825 predicted 891
8 SASI_Hs01_00043826 predicted 517
9 SASI_Hs01_00043827 predicted 777
10 SASI_Hs01_00043828 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144706
C2orf15 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144706.2-488s1c1
Sequence:CCGGGTTCAGCTATCCTAATGGGATCTCGAGATCCCATTAGGATAGCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144706.2-698s1c1
Sequence:CCGGGATCTCTTTCTGGGAAAGCCTCTCGAGAGGCTTTCCCAGAAAGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144706.2-669s1c1
Sequence:CCGGCTTTACAAGGATTGAAGGGACCTCGAGGTCCCTTCAATCCTTGTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144706.2-568s1c1
Sequence:CCGGGATCACTTAATACGAGGGACTCTCGAGAGTCCCTCGTATTAAGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144706.2-526s1c1
Sequence:CCGGGCTACTCAGGTATCTGCTATACTCGAGTATAGCAGATACCTGAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144706.2-1048s1c1
Sequence:CCGGCAGTATTTGAATGGCATCAAACTCGAGTTTGATGCCATTCAAATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121711    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144706.2-988s1c1
Sequence:CCGGCAAAGCAGATTTCTCTGGTATCTCGAGATACCAGAGAAATCTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144706.2-875s1c1
Sequence:CCGGGATGGAAGACTATTGCCTTATCTCGAGATAAGGCAATAGTCTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144706.2-851s1c1
Sequence:CCGGCTTATTAGGAAACCCTGACAACTCGAGTTGTCAGGGTTTCCTAATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144706
C2orf15 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144706.2-488s1c1
Sequence:CCGGGTTCAGCTATCCTAATGGGATCTCGAGATCCCATTAGGATAGCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144706.2-698s1c1
Sequence:CCGGGATCTCTTTCTGGGAAAGCCTCTCGAGAGGCTTTCCCAGAAAGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144706.2-669s1c1
Sequence:CCGGCTTTACAAGGATTGAAGGGACCTCGAGGTCCCTTCAATCCTTGTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144706.2-568s1c1
Sequence:CCGGGATCACTTAATACGAGGGACTCTCGAGAGTCCCTCGTATTAAGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144706.2-526s1c1
Sequence:CCGGGCTACTCAGGTATCTGCTATACTCGAGTATAGCAGATACCTGAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144706.2-1048s1c1
Sequence:CCGGCAGTATTTGAATGGCATCAAACTCGAGTTTGATGCCATTCAAATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121711    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144706.2-988s1c1
Sequence:CCGGCAAAGCAGATTTCTCTGGTATCTCGAGATACCAGAGAAATCTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144706.2-875s1c1
Sequence:CCGGGATGGAAGACTATTGCCTTATCTCGAGATAAGGCAATAGTCTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144706.2-851s1c1
Sequence:CCGGCTTATTAGGAAACCCTGACAACTCGAGTTGTCAGGGTTTCCTAATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144706
C2orf15 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144706.2-488s1c1
Sequence:CCGGGTTCAGCTATCCTAATGGGATCTCGAGATCCCATTAGGATAGCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144706.2-698s1c1
Sequence:CCGGGATCTCTTTCTGGGAAAGCCTCTCGAGAGGCTTTCCCAGAAAGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144706.2-669s1c1
Sequence:CCGGCTTTACAAGGATTGAAGGGACCTCGAGGTCCCTTCAATCCTTGTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144706.2-568s1c1
Sequence:CCGGGATCACTTAATACGAGGGACTCTCGAGAGTCCCTCGTATTAAGTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144706.2-526s1c1
Sequence:CCGGGCTACTCAGGTATCTGCTATACTCGAGTATAGCAGATACCTGAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144706.2-1048s1c1
Sequence:CCGGCAGTATTTGAATGGCATCAAACTCGAGTTTGATGCCATTCAAATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121711    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144706.2-988s1c1
Sequence:CCGGCAAAGCAGATTTCTCTGGTATCTCGAGATACCAGAGAAATCTGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144706.2-875s1c1
Sequence:CCGGGATGGAAGACTATTGCCTTATCTCGAGATAAGGCAATAGTCTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144706.2-851s1c1
Sequence:CCGGCTTATTAGGAAACCCTGACAACTCGAGTTGTCAGGGTTTCCTAATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)