EMAIL THIS PAGE TO A FRIEND

C2orf16

chromosome 2 open reading frame 16

Species: Human C2orf16(84226)
UniProtKB ID: Q68DN1, B9EIQ4, Q53S01, Q8ND64, Q9H088
Gene ID:
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032266 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032266 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147943 predicted 1490
2 SASI_Hs01_00147944 predicted 4269
3 SASI_Hs02_00359574 predicted 5320
4 SASI_Hs01_00147946 predicted 2666
5 SASI_Hs02_00359575 predicted 1078
6 SASI_Hs01_00147948 predicted 4306
7 SASI_Hs01_00147949 predicted 3815
8 SASI_Hs01_00147950 predicted 3681
9 SASI_Hs01_00147951 predicted 2574
10 SASI_Hs02_00359576 predicted 4366
11 SASI_Hs01_00147942 predicted 3171
12 SASI_Hs01_00147945 predicted 552
13 SASI_Hs01_00147947 predicted 1126
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032266
C2orf16 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 16
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-3874s1c1
Sequence:CCGGCGGGCTAAAGTGAGAACCAAACTCGAGTTTGGTTCTCACTTTAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-4238s1c1
Sequence:CCGGCCAGGGACTATTGCTTACCAACTCGAGTTGGTAAGCAATAGTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-4629s1c1
Sequence:CCGGGCACCGACATCTTAAAGACAACTCGAGTTGTCTTTAAGATGTCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-2523s1c1
Sequence:CCGGGACAACTAAGAGGAAGCAAATCTCGAGATTTGCTTCCTCTTAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-4091s1c1
Sequence:CCGGCCAAGTTCATGCAACTGCTTTCTCGAGAAAGCAGTTGCATGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032266.2-3021s1c1
Sequence:CCGGCTCTGGGACTAGAGTGAGAATCTCGAGATTCTCACTCTAGTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032266
C2orf16 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 16
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-3874s1c1
Sequence:CCGGCGGGCTAAAGTGAGAACCAAACTCGAGTTTGGTTCTCACTTTAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-4238s1c1
Sequence:CCGGCCAGGGACTATTGCTTACCAACTCGAGTTGGTAAGCAATAGTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-4629s1c1
Sequence:CCGGGCACCGACATCTTAAAGACAACTCGAGTTGTCTTTAAGATGTCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-2523s1c1
Sequence:CCGGGACAACTAAGAGGAAGCAAATCTCGAGATTTGCTTCCTCTTAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-4091s1c1
Sequence:CCGGCCAAGTTCATGCAACTGCTTTCTCGAGAAAGCAGTTGCATGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032266.2-3021s1c1
Sequence:CCGGCTCTGGGACTAGAGTGAGAATCTCGAGATTCTCACTCTAGTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032266
C2orf16 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 16
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-3874s1c1
Sequence:CCGGCGGGCTAAAGTGAGAACCAAACTCGAGTTTGGTTCTCACTTTAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-4238s1c1
Sequence:CCGGCCAGGGACTATTGCTTACCAACTCGAGTTGGTAAGCAATAGTCCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-4629s1c1
Sequence:CCGGGCACCGACATCTTAAAGACAACTCGAGTTGTCTTTAAGATGTCGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-2523s1c1
Sequence:CCGGGACAACTAAGAGGAAGCAAATCTCGAGATTTGCTTCCTCTTAGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032266.2-4091s1c1
Sequence:CCGGCCAAGTTCATGCAACTGCTTTCTCGAGAAAGCAGTTGCATGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032266.2-3021s1c1
Sequence:CCGGCTCTGGGACTAGAGTGAGAATCTCGAGATTCTCACTCTAGTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks