EMAIL THIS PAGE TO A FRIEND

C2orf27A

chromosome 2 open reading frame 27A

34 Gene Product Result for
Synonyms: C2orf27 C2orf27B
Species: Human C2orf27A(29798)
UniProtKB ID: Q580R0, O43575, Q2M1X0, Q52M10, Q86XG2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013310 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148541 MISSION® esiRNA esiRNA human C2orf27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013310 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344587 predicted 520
2 SASI_Hs02_00344588 predicted 603
3 SASI_Hs02_00344589 predicted 515
4 SASI_Hs02_00344590 predicted 458
5 SASI_Hs02_00344591 predicted 455
6 SASI_Hs02_00344592 predicted 510
7 SASI_Hs02_00344593 predicted 446
8 SASI_Hs02_00344594 predicted 587
9 SASI_Hs02_00344595 predicted 444
10 SASI_Hs02_00344596 predicted 518
11 SASI_Hs01_00242101 predicted 424
12 SASI_Hs01_00242102 predicted 1195
13 SASI_Hs01_00242103 predicted 1181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013310
C2orf27A MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 27A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013310.3-443s1c1
Sequence:CCGGCAGGTGCAGAAATACAGCGATCTCGAGATCGCTGTATTTCTGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013310.3-445s21c1
Sequence:CCGGGGTGCAGAAATACAGCGATTTCTCGAGAAATCGCTGTATTTCTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013310.3-799s21c1
Sequence:CCGGAGAGGGACTTCTCTCATTCAGCTCGAGCTGAATGAGAGAAGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013310.3-887s21c1
Sequence:CCGGGAGGTGCTGGAGAGCAAGAAACTCGAGTTTCTTGCTCTCCAGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013310.3-591s21c1
Sequence:CCGGTGAGGAGCTGCCTGACTTCATCTCGAGATGAAGTCAGGCAGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013310
C2orf27A MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 27A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013310.3-443s1c1
Sequence:CCGGCAGGTGCAGAAATACAGCGATCTCGAGATCGCTGTATTTCTGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013310.3-445s21c1
Sequence:CCGGGGTGCAGAAATACAGCGATTTCTCGAGAAATCGCTGTATTTCTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013310.3-799s21c1
Sequence:CCGGAGAGGGACTTCTCTCATTCAGCTCGAGCTGAATGAGAGAAGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013310.3-887s21c1
Sequence:CCGGGAGGTGCTGGAGAGCAAGAAACTCGAGTTTCTTGCTCTCCAGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013310.3-591s21c1
Sequence:CCGGTGAGGAGCTGCCTGACTTCATCTCGAGATGAAGTCAGGCAGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013310
C2orf27A MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 27A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013310.3-443s1c1
Sequence:CCGGCAGGTGCAGAAATACAGCGATCTCGAGATCGCTGTATTTCTGCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013310.3-445s21c1
Sequence:CCGGGGTGCAGAAATACAGCGATTTCTCGAGAAATCGCTGTATTTCTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013310.3-799s21c1
Sequence:CCGGAGAGGGACTTCTCTCATTCAGCTCGAGCTGAATGAGAGAAGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013310.3-887s21c1
Sequence:CCGGGAGGTGCTGGAGAGCAAGAAACTCGAGTTTCTTGCTCTCCAGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013310.3-591s21c1
Sequence:CCGGTGAGGAGCTGCCTGACTTCATCTCGAGATGAAGTCAGGCAGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks