EMAIL THIS PAGE TO A FRIEND

C2orf27B

chromosome 2 open reading frame 27B

Species: Human C2orf27B(408029)
Gene ID:
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_214461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_214461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_214461 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_214461 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_214461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152429 predicted 527
2 SASI_Hs02_00374361 predicted 624
3 SASI_Hs01_00152430 predicted 526
4 SASI_Hs02_00374362 predicted 707
5 SASI_Hs02_00374363 predicted 625
6 SASI_Hs02_00374364 predicted 555
7 SASI_Hs02_00374365 predicted 559
8 SASI_Hs02_00374366 predicted 615
9 SASI_Hs02_00374367 predicted 551
10 SASI_Hs02_00374368 predicted 696
11 SASI_Hs01_00152431 predicted 1292
12 SASI_Hs01_00152432 predicted 1289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_214461
C2orf27B MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 27B
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183737    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_214461.1-1245s1c1
Sequence:CCGGCCCAAGGATTTATTCATAGCTCTCGAGAGCTATGAATAAATCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_214461.1-1238s1c1
Sequence:CCGGGCACCTGCCCAAGGATTTATTCTCGAGAATAAATCCTTGGGCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_214461.1-528s1c1
Sequence:CCGGCAGAGACACTAGCTCCTGCTTCTCGAGAAGCAGGAGCTAGTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148648    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_214461.1-1241s1c1
Sequence:CCGGCCTGCCCAAGGATTTATTCATCTCGAGATGAATAAATCCTTGGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_214461
C2orf27B MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 27B
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183737    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_214461.1-1245s1c1
Sequence:CCGGCCCAAGGATTTATTCATAGCTCTCGAGAGCTATGAATAAATCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_214461.1-1238s1c1
Sequence:CCGGGCACCTGCCCAAGGATTTATTCTCGAGAATAAATCCTTGGGCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_214461.1-528s1c1
Sequence:CCGGCAGAGACACTAGCTCCTGCTTCTCGAGAAGCAGGAGCTAGTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148648    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_214461.1-1241s1c1
Sequence:CCGGCCTGCCCAAGGATTTATTCATCTCGAGATGAATAAATCCTTGGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_214461
C2orf27B MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 27B
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183737    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_214461.1-1245s1c1
Sequence:CCGGCCCAAGGATTTATTCATAGCTCTCGAGAGCTATGAATAAATCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184535    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_214461.1-1238s1c1
Sequence:CCGGGCACCTGCCCAAGGATTTATTCTCGAGAATAAATCCTTGGGCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_214461.1-528s1c1
Sequence:CCGGCAGAGACACTAGCTCCTGCTTCTCGAGAAGCAGGAGCTAGTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148648    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_214461.1-1241s1c1
Sequence:CCGGCCTGCCCAAGGATTTATTCATCTCGAGATGAATAAATCCTTGGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks