EMAIL THIS PAGE TO A FRIEND

C2orf40

chromosome 2 open reading frame 40

21 Gene Product Result for
Synonyms: ECRG4
Species: Human C2orf40(84417)
UniProtKB ID: Q9H1Z8, D3DVK2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032411 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032411 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032411 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010451 MISSION® esiRNA esiRNA targeting human C2orf40 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032411 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101365 predicted 228
2 SASI_Hs01_00101366 predicted 524
3 SASI_Hs01_00101367 predicted 447
4 SASI_Hs01_00101368 predicted 248
5 SASI_Hs01_00101369 predicted 350
6 SASI_Hs01_00101370 predicted 403
7 SASI_Hs02_00359806 predicted 555
8 SASI_Hs01_00101371 predicted 378
9 SASI_Hs01_00101372 predicted 422
10 SASI_Hs01_00101373 predicted 527
11 SASI_Hs01_00101374 predicted 425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032411
C2orf40 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 40
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032411.1-264s1c1
Sequence:CCGGCGTTGATGAGAATAAAGCCAACTCGAGTTGGCTTTATTCTCATCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032411.1-617s1c1
Sequence:CCGGGCCTTACACTACTTGGTTTCTCTCGAGAGAAACCAAGTAGTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032411.1-357s1c1
Sequence:CCGGGTACCAGCAGTTTCTCTACATCTCGAGATGTAGAGAAACTGCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032411.1-364s1c1
Sequence:CCGGCAGTTTCTCTACATGGGCTTTCTCGAGAAAGCCCATGTAGAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032411.1-440s1c1
Sequence:CCGGGACATGAATACTATGGCGATTCTCGAGAATCGCCATAGTATTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032411.1-428s1c1
Sequence:CCGGGAGATCGAAATGGACATGAATCTCGAGATTCATGTCCATTTCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032411.1-581s1c1
Sequence:CCGGGAAGCAAATAGCGATTCTCTTCTCGAGAAGAGAATCGCTATTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032411.1-569s1c1
Sequence:CCGGCACGCTGTACAAGAAGCAAATCTCGAGATTTGCTTCTTGTACAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032411.1-197s1c1
Sequence:CCGGGTGGAAATAAACTCAAGCTGACTCGAGTCAGCTTGAGTTTATTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032411.1-584s1c1
Sequence:CCGGGCAAATAGCGATTCTCTTCATCTCGAGATGAAGAGAATCGCTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032411
C2orf40 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 40
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032411.1-264s1c1
Sequence:CCGGCGTTGATGAGAATAAAGCCAACTCGAGTTGGCTTTATTCTCATCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032411.1-617s1c1
Sequence:CCGGGCCTTACACTACTTGGTTTCTCTCGAGAGAAACCAAGTAGTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032411.1-357s1c1
Sequence:CCGGGTACCAGCAGTTTCTCTACATCTCGAGATGTAGAGAAACTGCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032411.1-364s1c1
Sequence:CCGGCAGTTTCTCTACATGGGCTTTCTCGAGAAAGCCCATGTAGAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032411.1-440s1c1
Sequence:CCGGGACATGAATACTATGGCGATTCTCGAGAATCGCCATAGTATTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032411.1-428s1c1
Sequence:CCGGGAGATCGAAATGGACATGAATCTCGAGATTCATGTCCATTTCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032411.1-581s1c1
Sequence:CCGGGAAGCAAATAGCGATTCTCTTCTCGAGAAGAGAATCGCTATTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032411.1-569s1c1
Sequence:CCGGCACGCTGTACAAGAAGCAAATCTCGAGATTTGCTTCTTGTACAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032411.1-197s1c1
Sequence:CCGGGTGGAAATAAACTCAAGCTGACTCGAGTCAGCTTGAGTTTATTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032411.1-584s1c1
Sequence:CCGGGCAAATAGCGATTCTCTTCATCTCGAGATGAAGAGAATCGCTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032411
C2orf40 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 40
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032411.1-264s1c1
Sequence:CCGGCGTTGATGAGAATAAAGCCAACTCGAGTTGGCTTTATTCTCATCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032411.1-617s1c1
Sequence:CCGGGCCTTACACTACTTGGTTTCTCTCGAGAGAAACCAAGTAGTGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032411.1-357s1c1
Sequence:CCGGGTACCAGCAGTTTCTCTACATCTCGAGATGTAGAGAAACTGCTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148926    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032411.1-364s1c1
Sequence:CCGGCAGTTTCTCTACATGGGCTTTCTCGAGAAAGCCCATGTAGAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032411.1-440s1c1
Sequence:CCGGGACATGAATACTATGGCGATTCTCGAGAATCGCCATAGTATTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032411.1-428s1c1
Sequence:CCGGGAGATCGAAATGGACATGAATCTCGAGATTCATGTCCATTTCGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032411.1-581s1c1
Sequence:CCGGGAAGCAAATAGCGATTCTCTTCTCGAGAAGAGAATCGCTATTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148634    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032411.1-569s1c1
Sequence:CCGGCACGCTGTACAAGAAGCAAATCTCGAGATTTGCTTCTTGTACAGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032411.1-197s1c1
Sequence:CCGGGTGGAAATAAACTCAAGCTGACTCGAGTCAGCTTGAGTTTATTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032411.1-584s1c1
Sequence:CCGGGCAAATAGCGATTCTCTTCATCTCGAGATGAAGAGAATCGCTATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks