EMAIL THIS PAGE TO A FRIEND

C2orf42

chromosome 2 open reading frame 42

81 Gene Product Result for
Species: Human C2orf42(54980)
UniProtKB ID: Q9NWW7, D6W5G3, Q9H629
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017880 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017880 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017880 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039911 MISSION® esiRNA esiRNA human C2orf42 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017880 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017880 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226709 predicted 2152
2 SASI_Hs01_00226710 predicted 724
3 SASI_Hs01_00226711 predicted 1473
4 SASI_Hs01_00226712 predicted 1636
5 SASI_Hs01_00226713 predicted 1375
6 SASI_Hs02_00350819 predicted 774
7 SASI_Hs01_00226714 predicted 1205
8 SASI_Hs01_00226715 predicted 1493
9 SASI_Hs01_00226716 predicted 1682
10 SASI_Hs01_00226717 predicted 1610
11 SASI_Hs01_00226718 predicted 1194
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017880
C2orf42 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 42
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017880.1-577s1c1
Sequence:CCGGCCCTGATTACCGATGCTTTGTCTCGAGACAAAGCATCGGTAATCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017880.1-1265s1c1
Sequence:CCGGGCACAGATGAACAGTTCACTACTCGAGTAGTGAACTGTTCATCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017880.1-2175s1c1
Sequence:CCGGGCAAATTCTCAGTGCTTTCAACTCGAGTTGAAAGCACTGAGAATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017880.1-2333s1c1
Sequence:CCGGCGGACTCATCTTTAGCGTTTACTCGAGTAAACGCTAAAGATGAGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017880.1-1721s1c1
Sequence:CCGGGATGGGACTTATGAGCTATTTCTCGAGAAATAGCTCATAAGTCCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017880.1-1639s21c1
Sequence:CCGGCACTAATATCCTGCAAGTTAACTCGAGTTAACTTGCAGGATATTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017880.1-2108s21c1
Sequence:CCGGACAACTTTAAATGCTAGTTAGCTCGAGCTAACTAGCATTTAAAGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017880
C2orf42 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 42
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017880.1-577s1c1
Sequence:CCGGCCCTGATTACCGATGCTTTGTCTCGAGACAAAGCATCGGTAATCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017880.1-1265s1c1
Sequence:CCGGGCACAGATGAACAGTTCACTACTCGAGTAGTGAACTGTTCATCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017880.1-2175s1c1
Sequence:CCGGGCAAATTCTCAGTGCTTTCAACTCGAGTTGAAAGCACTGAGAATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017880.1-2333s1c1
Sequence:CCGGCGGACTCATCTTTAGCGTTTACTCGAGTAAACGCTAAAGATGAGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017880.1-1721s1c1
Sequence:CCGGGATGGGACTTATGAGCTATTTCTCGAGAAATAGCTCATAAGTCCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017880.1-1639s21c1
Sequence:CCGGCACTAATATCCTGCAAGTTAACTCGAGTTAACTTGCAGGATATTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017880.1-2108s21c1
Sequence:CCGGACAACTTTAAATGCTAGTTAGCTCGAGCTAACTAGCATTTAAAGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017880
C2orf42 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 42
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017880.1-577s1c1
Sequence:CCGGCCCTGATTACCGATGCTTTGTCTCGAGACAAAGCATCGGTAATCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168391    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017880.1-1265s1c1
Sequence:CCGGGCACAGATGAACAGTTCACTACTCGAGTAGTGAACTGTTCATCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167676    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017880.1-2175s1c1
Sequence:CCGGGCAAATTCTCAGTGCTTTCAACTCGAGTTGAAAGCACTGAGAATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017880.1-2333s1c1
Sequence:CCGGCGGACTCATCTTTAGCGTTTACTCGAGTAAACGCTAAAGATGAGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017880.1-1721s1c1
Sequence:CCGGGATGGGACTTATGAGCTATTTCTCGAGAAATAGCTCATAAGTCCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017880.1-1639s21c1
Sequence:CCGGCACTAATATCCTGCAAGTTAACTCGAGTTAACTTGCAGGATATTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017880.1-2108s21c1
Sequence:CCGGACAACTTTAAATGCTAGTTAGCTCGAGCTAACTAGCATTTAAAGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)