EMAIL THIS PAGE TO A FRIEND

C2orf43

chromosome 2 open reading frame 43

45 Gene Product Result for
Species: Human C2orf43(60526)
UniProtKB ID: Q9H6V9, D6W530, Q53T37, Q53T58
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021925 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155681 MISSION® esiRNA esiRNA human C2orf43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021925 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074173 predicted 348
2 SASI_Hs01_00074175 predicted 432
3 SASI_Hs01_00074176 predicted 1057
4 SASI_Hs01_00074178 predicted 582
5 SASI_Hs01_00074179 predicted 398
6 SASI_Hs01_00074180 predicted 639
7 SASI_Hs02_00355205 predicted 790
8 SASI_Hs01_00074182 predicted 379
9 SASI_Hs02_00355206 predicted 438
10 SASI_Hs02_00355207 predicted 636
11 SASI_Hs01_00074174 predicted 790
12 SASI_Hs01_00074177 predicted 544
13 SASI_Hs01_00074181 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021925
C2orf43 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 43
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021925.1-329s1c1
Sequence:CCGGGAGGATTCAAACGCTCAAGAACTCGAGTTCTTGAGCGTTTGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021925.1-2001s1c1
Sequence:CCGGGCCATACATTAACTCTCCATTCTCGAGAATGGAGAGTTAATGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021925.1-929s1c1
Sequence:CCGGCCTCATGCTTTCATCACCCATCTCGAGATGGGTGATGAAAGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021925.1-2074s1c1
Sequence:CCGGCCAGCCATTAAGTTATGTGAACTCGAGTTCACATAACTTAATGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021925.1-643s1c1
Sequence:CCGGGACAATCAAGTCCTTGCTAATCTCGAGATTAGCAAGGACTTGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021925.1-296s1c1
Sequence:CCGGGCTCCCAAAGACAAGAAGATTCTCGAGAATCTTCTTGTCTTTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021925.1-985s1c1
Sequence:CCGGCCTAAAGGATGACTTGTCCAACTCGAGTTGGACAAGTCATCCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021925.1-1156s1c1
Sequence:CCGGGCCATGTTATAGGCTGAAGTACTCGAGTACTTCAGCCTATAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021925
C2orf43 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 43
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021925.1-329s1c1
Sequence:CCGGGAGGATTCAAACGCTCAAGAACTCGAGTTCTTGAGCGTTTGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021925.1-2001s1c1
Sequence:CCGGGCCATACATTAACTCTCCATTCTCGAGAATGGAGAGTTAATGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021925.1-929s1c1
Sequence:CCGGCCTCATGCTTTCATCACCCATCTCGAGATGGGTGATGAAAGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021925.1-2074s1c1
Sequence:CCGGCCAGCCATTAAGTTATGTGAACTCGAGTTCACATAACTTAATGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021925.1-643s1c1
Sequence:CCGGGACAATCAAGTCCTTGCTAATCTCGAGATTAGCAAGGACTTGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021925.1-296s1c1
Sequence:CCGGGCTCCCAAAGACAAGAAGATTCTCGAGAATCTTCTTGTCTTTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021925.1-985s1c1
Sequence:CCGGCCTAAAGGATGACTTGTCCAACTCGAGTTGGACAAGTCATCCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021925.1-1156s1c1
Sequence:CCGGGCCATGTTATAGGCTGAAGTACTCGAGTACTTCAGCCTATAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021925
C2orf43 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 43
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021925.1-329s1c1
Sequence:CCGGGAGGATTCAAACGCTCAAGAACTCGAGTTCTTGAGCGTTTGAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021925.1-2001s1c1
Sequence:CCGGGCCATACATTAACTCTCCATTCTCGAGAATGGAGAGTTAATGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021925.1-929s1c1
Sequence:CCGGCCTCATGCTTTCATCACCCATCTCGAGATGGGTGATGAAAGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021925.1-2074s1c1
Sequence:CCGGCCAGCCATTAAGTTATGTGAACTCGAGTTCACATAACTTAATGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021925.1-643s1c1
Sequence:CCGGGACAATCAAGTCCTTGCTAATCTCGAGATTAGCAAGGACTTGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021925.1-296s1c1
Sequence:CCGGGCTCCCAAAGACAAGAAGATTCTCGAGAATCTTCTTGTCTTTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021925.1-985s1c1
Sequence:CCGGCCTAAAGGATGACTTGTCCAACTCGAGTTGGACAAGTCATCCTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149469    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021925.1-1156s1c1
Sequence:CCGGGCCATGTTATAGGCTGAAGTACTCGAGTACTTCAGCCTATAACATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks