EMAIL THIS PAGE TO A FRIEND

C2orf44

chromosome 2 open reading frame 44

29 Gene Product Result for
Species: Human C2orf44(80304)
UniProtKB ID: Q9H6R7, D6W532, Q8IYK0, Q9HBP5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025203 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012811 MISSION® esiRNA esiRNA targeting human C2orf44 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025203 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035205 predicted 1402
2 SASI_Hs01_00035206 predicted 1825
3 SASI_Hs01_00035207 predicted 1383
4 SASI_Hs01_00035208 predicted 1033
5 SASI_Hs01_00035209 predicted 1761
6 SASI_Hs01_00035210 predicted 1148
7 SASI_Hs01_00035211 predicted 349
8 SASI_Hs01_00035212 predicted 714
9 SASI_Hs01_00035213 predicted 426
10 SASI_Hs01_00035214 predicted 778
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025203
VALIDATED
C2orf44 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 44
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025203.1-1726s1c1
Sequence:CCGGGCTGTCTAAGGAGGTGGAAATCTCGAGATTTCCACCTCCTTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025203.1-182s1c1
Sequence:CCGGCACAGTGGAGAGGTCAAGTTTCTCGAGAAACTTGACCTCTCCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025203.1-363s1c1
Sequence:CCGGCGTCTCAGACTTGTGAGATTACTCGAGTAATCTCACAAGTCTGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025203.1-775s1c1
Sequence:CCGGCCCACCTAACAGTAAAGACATCTCGAGATGTCTTTACTGTTAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025203.1-800s1c1
Sequence:CCGGCCGTATGCTTTACCAGTTATTCTCGAGAATAACTGGTAAAGCATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025203.1-3139s1c1
Sequence:CCGGGCAGAGAATCTGTGAGAGAAACTCGAGTTTCTCTCACAGATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025203.2-1479s21c1
Sequence:CCGGACTTTCAGTGCTCCGTTAAATCTCGAGATTTAACGGAGCACTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025203.2-873s21c1
Sequence:CCGGCCGTATGCTTTACCAGTTATTCTCGAGAATAACTGGTAAAGCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025203.2-768s21c1
Sequence:CCGGGTGGACTCACAGGTTGCTATACTCGAGTATAGCAACCTGTGAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025203.2-1007s21c1
Sequence:CCGGACATAAGTCTGAGGGTAATTCCTCGAGGAATTACCCTCAGACTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025203.2-3212s21c1
Sequence:CCGGGCAGAGAATCTGTGAGAGAAACTCGAGTTTCTCTCACAGATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025203
VALIDATED
C2orf44 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 44
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025203.1-1726s1c1
Sequence:CCGGGCTGTCTAAGGAGGTGGAAATCTCGAGATTTCCACCTCCTTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025203.1-182s1c1
Sequence:CCGGCACAGTGGAGAGGTCAAGTTTCTCGAGAAACTTGACCTCTCCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025203.1-363s1c1
Sequence:CCGGCGTCTCAGACTTGTGAGATTACTCGAGTAATCTCACAAGTCTGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025203.1-775s1c1
Sequence:CCGGCCCACCTAACAGTAAAGACATCTCGAGATGTCTTTACTGTTAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025203.1-800s1c1
Sequence:CCGGCCGTATGCTTTACCAGTTATTCTCGAGAATAACTGGTAAAGCATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025203.1-3139s1c1
Sequence:CCGGGCAGAGAATCTGTGAGAGAAACTCGAGTTTCTCTCACAGATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025203.2-1479s21c1
Sequence:CCGGACTTTCAGTGCTCCGTTAAATCTCGAGATTTAACGGAGCACTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025203.2-873s21c1
Sequence:CCGGCCGTATGCTTTACCAGTTATTCTCGAGAATAACTGGTAAAGCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025203.2-768s21c1
Sequence:CCGGGTGGACTCACAGGTTGCTATACTCGAGTATAGCAACCTGTGAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025203.2-1007s21c1
Sequence:CCGGACATAAGTCTGAGGGTAATTCCTCGAGGAATTACCCTCAGACTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025203.2-3212s21c1
Sequence:CCGGGCAGAGAATCTGTGAGAGAAACTCGAGTTTCTCTCACAGATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025203
VALIDATED
C2orf44 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 44
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025203.1-1726s1c1
Sequence:CCGGGCTGTCTAAGGAGGTGGAAATCTCGAGATTTCCACCTCCTTAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025203.1-182s1c1
Sequence:CCGGCACAGTGGAGAGGTCAAGTTTCTCGAGAAACTTGACCTCTCCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135205    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025203.1-363s1c1
Sequence:CCGGCGTCTCAGACTTGTGAGATTACTCGAGTAATCTCACAAGTCTGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025203.1-775s1c1
Sequence:CCGGCCCACCTAACAGTAAAGACATCTCGAGATGTCTTTACTGTTAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025203.1-800s1c1
Sequence:CCGGCCGTATGCTTTACCAGTTATTCTCGAGAATAACTGGTAAAGCATACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025203.1-3139s1c1
Sequence:CCGGGCAGAGAATCTGTGAGAGAAACTCGAGTTTCTCTCACAGATTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025203.2-1479s21c1
Sequence:CCGGACTTTCAGTGCTCCGTTAAATCTCGAGATTTAACGGAGCACTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025203.2-873s21c1
Sequence:CCGGCCGTATGCTTTACCAGTTATTCTCGAGAATAACTGGTAAAGCATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025203.2-768s21c1
Sequence:CCGGGTGGACTCACAGGTTGCTATACTCGAGTATAGCAACCTGTGAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025203.2-1007s21c1
Sequence:CCGGACATAAGTCTGAGGGTAATTCCTCGAGGAATTACCCTCAGACTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025203.2-3212s21c1
Sequence:CCGGGCAGAGAATCTGTGAGAGAAACTCGAGTTTCTCTCACAGATTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks