EMAIL THIS PAGE TO A FRIEND

C2orf47

chromosome 2 open reading frame 47

25 Gene Product Result for
UniProtKB ID: Q8WWC4, Q658V9, Q9H671
Gene ID:
chicken(424066) chromosome 7 open reading frame, human C2orf47
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024520 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053211 MISSION® esiRNA esiRNA human C2orf47 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024520 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071564 predicted 1028
2 SASI_Hs01_00071565 predicted 965
3 SASI_Hs01_00071567 predicted 1211
4 SASI_Hs01_00071568 predicted 1222
5 SASI_Hs02_00356799 predicted 846
6 SASI_Hs01_00071569 predicted 909
7 SASI_Hs01_00071570 predicted 800
8 SASI_Hs01_00071572 predicted 1049
9 SASI_Hs02_00356800 predicted 1210
10 SASI_Hs02_00356801 predicted 963
11 SASI_Hs01_00071563 predicted 1268
12 SASI_Hs01_00071566 predicted 700
13 SASI_Hs01_00071571 predicted 1082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024520
VALIDATED
C2orf47 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 47
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.2-793s21c1
Sequence:CCGGGTTGCTGTCACAGTGTAAATTCTCGAGAATTTACACTGTGACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.2-714s21c1
Sequence:CCGGTCTGGGCCTATTTCGACAAAGCTCGAGCTTTGTCGAAATAGGCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-842s21c1
Sequence:CCGGGAGGTGCTACATGCATTGAAACTCGAGTTTCAATGCATGTAGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-1130s21c1
Sequence:CCGGGAGTTCACACAAGGAGTAAAGCTCGAGCTTTACTCCTTGTGTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-875s21c1
Sequence:CCGGTCACTACCTGACAACCATAAACTCGAGTTTATGGTTGTCAGGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-897s21c1
Sequence:CCGGATGCCCTTGCTGCTAACATAGCTCGAGCTATGTTAGCAGCAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-1281s21c1
Sequence:CCGGCACTTAATCTAAGTCTGTGAACTCGAGTTCACAGACTTAGATTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.2-682s21c1
Sequence:CCGGCTGGGTTAGGACTCGAATTAACTCGAGTTAATTCGAGTCCTAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024520.1-842s1c1
Sequence:CCGGGAGGTGCTACATGCATTGAAACTCGAGTTTCAATGCATGTAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024520.1-705s1c1
Sequence:CCGGCCTTCCTTATCTGGGCCTATTCTCGAGAATAGGCCCAGATAAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024520.1-679s1c1
Sequence:CCGGCAACTGGGTTAGGACTCGAATCTCGAGATTCGAGTCCTAACCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024520.1-1369s1c1
Sequence:CCGGCAGATTGTTATCACCTTCTTTCTCGAGAAAGAAGGTGATAACAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024520.1-1281s1c1
Sequence:CCGGCACTTAATCTAAGTCTGTGAACTCGAGTTCACAGACTTAGATTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024520.1-1329s1c1
Sequence:CCGGCTTGCAGTATATTGGCATGATCTCGAGATCATGCCAATATACTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024520
VALIDATED
C2orf47 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 47
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.2-793s21c1
Sequence:CCGGGTTGCTGTCACAGTGTAAATTCTCGAGAATTTACACTGTGACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.2-714s21c1
Sequence:CCGGTCTGGGCCTATTTCGACAAAGCTCGAGCTTTGTCGAAATAGGCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-842s21c1
Sequence:CCGGGAGGTGCTACATGCATTGAAACTCGAGTTTCAATGCATGTAGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-1130s21c1
Sequence:CCGGGAGTTCACACAAGGAGTAAAGCTCGAGCTTTACTCCTTGTGTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-875s21c1
Sequence:CCGGTCACTACCTGACAACCATAAACTCGAGTTTATGGTTGTCAGGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-897s21c1
Sequence:CCGGATGCCCTTGCTGCTAACATAGCTCGAGCTATGTTAGCAGCAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-1281s21c1
Sequence:CCGGCACTTAATCTAAGTCTGTGAACTCGAGTTCACAGACTTAGATTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.2-682s21c1
Sequence:CCGGCTGGGTTAGGACTCGAATTAACTCGAGTTAATTCGAGTCCTAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024520.1-842s1c1
Sequence:CCGGGAGGTGCTACATGCATTGAAACTCGAGTTTCAATGCATGTAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024520.1-705s1c1
Sequence:CCGGCCTTCCTTATCTGGGCCTATTCTCGAGAATAGGCCCAGATAAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024520.1-679s1c1
Sequence:CCGGCAACTGGGTTAGGACTCGAATCTCGAGATTCGAGTCCTAACCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024520.1-1369s1c1
Sequence:CCGGCAGATTGTTATCACCTTCTTTCTCGAGAAAGAAGGTGATAACAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024520.1-1281s1c1
Sequence:CCGGCACTTAATCTAAGTCTGTGAACTCGAGTTCACAGACTTAGATTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024520.1-1329s1c1
Sequence:CCGGCTTGCAGTATATTGGCATGATCTCGAGATCATGCCAATATACTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024520
VALIDATED
C2orf47 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 47
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.2-793s21c1
Sequence:CCGGGTTGCTGTCACAGTGTAAATTCTCGAGAATTTACACTGTGACAGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.2-714s21c1
Sequence:CCGGTCTGGGCCTATTTCGACAAAGCTCGAGCTTTGTCGAAATAGGCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-842s21c1
Sequence:CCGGGAGGTGCTACATGCATTGAAACTCGAGTTTCAATGCATGTAGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-1130s21c1
Sequence:CCGGGAGTTCACACAAGGAGTAAAGCTCGAGCTTTACTCCTTGTGTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-875s21c1
Sequence:CCGGTCACTACCTGACAACCATAAACTCGAGTTTATGGTTGTCAGGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-897s21c1
Sequence:CCGGATGCCCTTGCTGCTAACATAGCTCGAGCTATGTTAGCAGCAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285371    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.1-1281s21c1
Sequence:CCGGCACTTAATCTAAGTCTGTGAACTCGAGTTCACAGACTTAGATTAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024520.2-682s21c1
Sequence:CCGGCTGGGTTAGGACTCGAATTAACTCGAGTTAATTCGAGTCCTAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024520.1-842s1c1
Sequence:CCGGGAGGTGCTACATGCATTGAAACTCGAGTTTCAATGCATGTAGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024520.1-705s1c1
Sequence:CCGGCCTTCCTTATCTGGGCCTATTCTCGAGAATAGGCCCAGATAAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024520.1-679s1c1
Sequence:CCGGCAACTGGGTTAGGACTCGAATCTCGAGATTCGAGTCCTAACCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024520.1-1369s1c1
Sequence:CCGGCAGATTGTTATCACCTTCTTTCTCGAGAAAGAAGGTGATAACAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024520.1-1281s1c1
Sequence:CCGGCACTTAATCTAAGTCTGTGAACTCGAGTTCACAGACTTAGATTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144086    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024520.1-1329s1c1
Sequence:CCGGCTTGCAGTATATTGGCATGATCTCGAGATCATGCCAATATACTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks