EMAIL THIS PAGE TO A FRIEND

C2orf48

chromosome 2 open reading frame 48

59 Gene Product Result for
Species: Human C2orf48(348738)
UniProtKB ID: Q96LS8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182626 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182626 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169715 predicted 615
2 SASI_Hs01_00169716 predicted 622
3 SASI_Hs02_00370772 predicted 414
4 SASI_Hs02_00370773 predicted 384
5 SASI_Hs02_00370774 predicted 475
6 SASI_Hs02_00370775 predicted 455
7 SASI_Hs02_00370776 predicted 528
8 SASI_Hs02_00370777 predicted 671
9 SASI_Hs02_00370778 predicted 579
10 SASI_Hs02_00370779 predicted 378
11 SASI_Hs01_00169713 predicted 607
12 SASI_Hs01_00169714 predicted 676
13 SASI_Hs01_00169717 predicted 614
14 SASI_Hs01_00169718 predicted 621
15 SASI_Hs01_00169719 predicted 553
16 SASI_Hs01_00169720 predicted 623
17 SASI_Hs01_00169721 predicted 549
18 SASI_Hs01_00169722 predicted 673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182626
C2orf48 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 48
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182626.1-475s1c1
Sequence:CCGGGCTTTCAGTCTTCCAGGATCTCTCGAGAGATCCTGGAAGACTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182626.1-1139s1c1
Sequence:CCGGCCCAGAGCTGTGAGAAATAAACTCGAGTTTATTTCTCACAGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182626.1-392s1c1
Sequence:CCGGCCTTACGTCTTGAAAGGGAATCTCGAGATTCCCTTTCAAGACGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182626.1-613s1c1
Sequence:CCGGGCGACCCTGTTTCAGAATGAACTCGAGTTCATTCTGAAACAGGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182626.1-642s21c1
Sequence:CCGGGGTGGGAACTCACCAAGAATGCTCGAGCATTCTTGGTGAGTTCCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182626.1-763s21c1
Sequence:CCGGCCCATAGACAGCAGATCTGCTCTCGAGAGCAGATCTGCTGTCTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182626.1-1164s21c1
Sequence:CCGGTGTTGTTTAAGGCACTCAATACTCGAGTATTGAGTGCCTTAAACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182626
C2orf48 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 48
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182626.1-475s1c1
Sequence:CCGGGCTTTCAGTCTTCCAGGATCTCTCGAGAGATCCTGGAAGACTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182626.1-1139s1c1
Sequence:CCGGCCCAGAGCTGTGAGAAATAAACTCGAGTTTATTTCTCACAGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182626.1-392s1c1
Sequence:CCGGCCTTACGTCTTGAAAGGGAATCTCGAGATTCCCTTTCAAGACGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182626.1-613s1c1
Sequence:CCGGGCGACCCTGTTTCAGAATGAACTCGAGTTCATTCTGAAACAGGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182626.1-642s21c1
Sequence:CCGGGGTGGGAACTCACCAAGAATGCTCGAGCATTCTTGGTGAGTTCCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182626.1-763s21c1
Sequence:CCGGCCCATAGACAGCAGATCTGCTCTCGAGAGCAGATCTGCTGTCTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182626.1-1164s21c1
Sequence:CCGGTGTTGTTTAAGGCACTCAATACTCGAGTATTGAGTGCCTTAAACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182626
C2orf48 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 48
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182626.1-475s1c1
Sequence:CCGGGCTTTCAGTCTTCCAGGATCTCTCGAGAGATCCTGGAAGACTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182626.1-1139s1c1
Sequence:CCGGCCCAGAGCTGTGAGAAATAAACTCGAGTTTATTTCTCACAGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182626.1-392s1c1
Sequence:CCGGCCTTACGTCTTGAAAGGGAATCTCGAGATTCCCTTTCAAGACGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182626.1-613s1c1
Sequence:CCGGGCGACCCTGTTTCAGAATGAACTCGAGTTCATTCTGAAACAGGGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182626.1-642s21c1
Sequence:CCGGGGTGGGAACTCACCAAGAATGCTCGAGCATTCTTGGTGAGTTCCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182626.1-763s21c1
Sequence:CCGGCCCATAGACAGCAGATCTGCTCTCGAGAGCAGATCTGCTGTCTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182626.1-1164s21c1
Sequence:CCGGTGTTGTTTAAGGCACTCAATACTCGAGTATTGAGTGCCTTAAACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks