EMAIL THIS PAGE TO A FRIEND

C2orf49

chromosome 2 open reading frame 49

31 Gene Product Result for
Synonyms: asw
Species: Human C2orf49(79074)
UniProtKB ID: Q9BVC5, B3KXN3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024093 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024093 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024093 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047631 MISSION® esiRNA esiRNA human C2orf49 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024093 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024093 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130281 predicted 616
2 SASI_Hs01_00130282 predicted 499
3 SASI_Hs01_00130283 predicted 614
4 SASI_Hs01_00130284 predicted 418
5 SASI_Hs01_00130285 predicted 335
6 SASI_Hs01_00130286 predicted 386
7 SASI_Hs01_00130287 predicted 330
8 SASI_Hs01_00130288 predicted 387
9 SASI_Hs01_00130289 predicted 295
10 SASI_Hs01_00130290 predicted 211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024093
C2orf49 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 49
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024093.1-217s21c1
Sequence:CCGGAGAGGGATTTGCCGAAGAATACTCGAGTATTCTTCGGCAAATCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024093.1-171s21c1
Sequence:CCGGGACAGTCTTACTGACCTTTATCTCGAGATAAAGGTCAGTAAGACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024093.1-619s21c1
Sequence:CCGGGAACTACTCCAGTGAAGTTAACTCGAGTTAACTTCACTGGAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024093.1-749s1c1
Sequence:CCGGTGTAAATATACTGTAACTGTACTCGAGTACAGTTACAGTATATTTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024093.1-542s1c1
Sequence:CCGGCGCTAAACAGAACCATGACTTCTCGAGAAGTCATGGTTCTGTTTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024093.1-422s1c1
Sequence:CCGGGCAGGCAAGCTTTACCAGTAACTCGAGTTACTGGTAAAGCTTGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024093.1-554s1c1
Sequence:CCGGCCATGACTTAACGCATAGGAACTCGAGTTCCTATGCGTTAAGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024093.1-331s1c1
Sequence:CCGGCCCTCATCGTATTTGATGGAACTCGAGTTCCATCAAATACGATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024093
C2orf49 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 49
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024093.1-217s21c1
Sequence:CCGGAGAGGGATTTGCCGAAGAATACTCGAGTATTCTTCGGCAAATCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024093.1-171s21c1
Sequence:CCGGGACAGTCTTACTGACCTTTATCTCGAGATAAAGGTCAGTAAGACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024093.1-619s21c1
Sequence:CCGGGAACTACTCCAGTGAAGTTAACTCGAGTTAACTTCACTGGAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024093.1-749s1c1
Sequence:CCGGTGTAAATATACTGTAACTGTACTCGAGTACAGTTACAGTATATTTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024093.1-542s1c1
Sequence:CCGGCGCTAAACAGAACCATGACTTCTCGAGAAGTCATGGTTCTGTTTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024093.1-422s1c1
Sequence:CCGGGCAGGCAAGCTTTACCAGTAACTCGAGTTACTGGTAAAGCTTGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024093.1-554s1c1
Sequence:CCGGCCATGACTTAACGCATAGGAACTCGAGTTCCTATGCGTTAAGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024093.1-331s1c1
Sequence:CCGGCCCTCATCGTATTTGATGGAACTCGAGTTCCATCAAATACGATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024093
C2orf49 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 49
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024093.1-217s21c1
Sequence:CCGGAGAGGGATTTGCCGAAGAATACTCGAGTATTCTTCGGCAAATCCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024093.1-171s21c1
Sequence:CCGGGACAGTCTTACTGACCTTTATCTCGAGATAAAGGTCAGTAAGACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024093.1-619s21c1
Sequence:CCGGGAACTACTCCAGTGAAGTTAACTCGAGTTAACTTCACTGGAGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005766    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024093.1-749s1c1
Sequence:CCGGTGTAAATATACTGTAACTGTACTCGAGTACAGTTACAGTATATTTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024093.1-542s1c1
Sequence:CCGGCGCTAAACAGAACCATGACTTCTCGAGAAGTCATGGTTCTGTTTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024093.1-422s1c1
Sequence:CCGGGCAGGCAAGCTTTACCAGTAACTCGAGTTACTGGTAAAGCTTGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024093.1-554s1c1
Sequence:CCGGCCATGACTTAACGCATAGGAACTCGAGTTCCTATGCGTTAAGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024093.1-331s1c1
Sequence:CCGGCCCTCATCGTATTTGATGGAACTCGAGTTCCATCAAATACGATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks