EMAIL THIS PAGE TO A FRIEND

C2orf50

chromosome 2 open reading frame 50

23 Gene Product Result for
Species: Human C2orf50(130813)
UniProtKB ID: Q96LR7, A8K9W3, D6W503
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182500 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055331 MISSION® esiRNA esiRNA human C2orf50 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182500 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040857 predicted 555
2 SASI_Hs01_00040858 predicted 551
3 SASI_Hs01_00040859 predicted 612
4 SASI_Hs01_00040860 predicted 574
5 SASI_Hs01_00040861 predicted 704
6 SASI_Hs01_00040862 predicted 635
7 SASI_Hs01_00040863 predicted 642
8 SASI_Hs02_00370553 predicted 550
9 SASI_Hs01_00040865 predicted 567
10 SASI_Hs01_00040866 predicted 700
11 SASI_Hs01_00040864 predicted 592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182500
C2orf50 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 50
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182500.1-2503s1c1
Sequence:CCGGCCACACTGACACACAAACAAACTCGAGTTTGTTTGTGTGTCAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182500.1-555s1c1
Sequence:CCGGCTGGAGTTTCCTGAAAGACTACTCGAGTAGTCTTTCAGGAAACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182500.1-1410s1c1
Sequence:CCGGGCATCTTCAAATCAGTCTCTACTCGAGTAGAGACTGATTTGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182500.1-565s1c1
Sequence:CCGGCTGAAAGACTATGACCCAATGCTCGAGCATTGGGTCATAGTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182500.1-564s1c1
Sequence:CCGGCCTGAAAGACTATGACCCAATCTCGAGATTGGGTCATAGTCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182500.1-546s1c1
Sequence:CCGGGATTCAGAACTGGAGTTTCCTCTCGAGAGGAAACTCCAGTTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182500.2-636s21c1
Sequence:CCGGAGTTCCCAGTTCCACGAACCACTCGAGTGGTTCGTGGAACTGGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182500.2-810s21c1
Sequence:CCGGACAGGACAGGACACGTTATTTCTCGAGAAATAACGTGTCCTGTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182500.2-598s21c1
Sequence:CCGGGAGAAGTTGCCAGACCATGTGCTCGAGCACATGGTCTGGCAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182500
C2orf50 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 50
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182500.1-2503s1c1
Sequence:CCGGCCACACTGACACACAAACAAACTCGAGTTTGTTTGTGTGTCAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182500.1-555s1c1
Sequence:CCGGCTGGAGTTTCCTGAAAGACTACTCGAGTAGTCTTTCAGGAAACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182500.1-1410s1c1
Sequence:CCGGGCATCTTCAAATCAGTCTCTACTCGAGTAGAGACTGATTTGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182500.1-565s1c1
Sequence:CCGGCTGAAAGACTATGACCCAATGCTCGAGCATTGGGTCATAGTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182500.1-564s1c1
Sequence:CCGGCCTGAAAGACTATGACCCAATCTCGAGATTGGGTCATAGTCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182500.1-546s1c1
Sequence:CCGGGATTCAGAACTGGAGTTTCCTCTCGAGAGGAAACTCCAGTTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182500.2-636s21c1
Sequence:CCGGAGTTCCCAGTTCCACGAACCACTCGAGTGGTTCGTGGAACTGGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182500.2-810s21c1
Sequence:CCGGACAGGACAGGACACGTTATTTCTCGAGAAATAACGTGTCCTGTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182500.2-598s21c1
Sequence:CCGGGAGAAGTTGCCAGACCATGTGCTCGAGCACATGGTCTGGCAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182500
C2orf50 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 50
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182500.1-2503s1c1
Sequence:CCGGCCACACTGACACACAAACAAACTCGAGTTTGTTTGTGTGTCAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146404    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182500.1-555s1c1
Sequence:CCGGCTGGAGTTTCCTGAAAGACTACTCGAGTAGTCTTTCAGGAAACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182500.1-1410s1c1
Sequence:CCGGGCATCTTCAAATCAGTCTCTACTCGAGTAGAGACTGATTTGAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182500.1-565s1c1
Sequence:CCGGCTGAAAGACTATGACCCAATGCTCGAGCATTGGGTCATAGTCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182500.1-564s1c1
Sequence:CCGGCCTGAAAGACTATGACCCAATCTCGAGATTGGGTCATAGTCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182500.1-546s1c1
Sequence:CCGGGATTCAGAACTGGAGTTTCCTCTCGAGAGGAAACTCCAGTTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182500.2-636s21c1
Sequence:CCGGAGTTCCCAGTTCCACGAACCACTCGAGTGGTTCGTGGAACTGGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182500.2-810s21c1
Sequence:CCGGACAGGACAGGACACGTTATTTCTCGAGAAATAACGTGTCCTGTCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182500.2-598s21c1
Sequence:CCGGGAGAAGTTGCCAGACCATGTGCTCGAGCACATGGTCTGGCAACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks