EMAIL THIS PAGE TO A FRIEND

C2orf53

chromosome 2 open reading frame 53

40 Gene Product Result for
Species: Human C2orf53(339779)
UniProtKB ID: Q53SZ7, Q86UE2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178553 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027221 MISSION® esiRNA esiRNA human C2orf53 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178553 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369800 predicted 663
2 SASI_Hs01_00213828 predicted 1389
3 SASI_Hs01_00213829 predicted 1661
4 SASI_Hs01_00213830 predicted 1312
5 SASI_Hs01_00213831 predicted 1439
6 SASI_Hs01_00213832 predicted 1398
7 SASI_Hs01_00213833 predicted 1507
8 SASI_Hs01_00213834 predicted 1692
9 SASI_Hs01_00213835 predicted 1647
10 SASI_Hs01_00213836 predicted 1639
11 SASI_Hs01_00213837 predicted 1520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178553
C2orf53 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 53
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-1779s21c1
Sequence:CCGGCAGTTTCTCTGGAGCTCATTCCTCGAGGAATGAGCTCCAGAGAAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-1315s21c1
Sequence:CCGGAGTCGTGGAGTATCCTATATGCTCGAGCATATAGGATACTCCACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-1076s21c1
Sequence:CCGGTCTCATAGGCTCCACTCTAACCTCGAGGTTAGAGTGGAGCCTATGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-797s21c1
Sequence:CCGGTTCGGCTCTTGTGACTCAAATCTCGAGATTTGAGTCACAAGAGCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-822s21c1
Sequence:CCGGACTTTGCTCCACATCCCTATTCTCGAGAATAGGGATGTGGAGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178553.2-594s1c1
Sequence:CCGGGCTTCTCACAACTTGTGGACTCTCGAGAGTCCACAAGTTGTGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178553.2-1522s1c1
Sequence:CCGGGCATCAATTGCCAGCATCTCACTCGAGTGAGATGCTGGCAATTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178553.2-1264s1c1
Sequence:CCGGCGTGGAGTATCCTATATGCCTCTCGAGAGGCATATAGGATACTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178553
C2orf53 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 53
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-1779s21c1
Sequence:CCGGCAGTTTCTCTGGAGCTCATTCCTCGAGGAATGAGCTCCAGAGAAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-1315s21c1
Sequence:CCGGAGTCGTGGAGTATCCTATATGCTCGAGCATATAGGATACTCCACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-1076s21c1
Sequence:CCGGTCTCATAGGCTCCACTCTAACCTCGAGGTTAGAGTGGAGCCTATGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-797s21c1
Sequence:CCGGTTCGGCTCTTGTGACTCAAATCTCGAGATTTGAGTCACAAGAGCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-822s21c1
Sequence:CCGGACTTTGCTCCACATCCCTATTCTCGAGAATAGGGATGTGGAGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178553.2-594s1c1
Sequence:CCGGGCTTCTCACAACTTGTGGACTCTCGAGAGTCCACAAGTTGTGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178553.2-1522s1c1
Sequence:CCGGGCATCAATTGCCAGCATCTCACTCGAGTGAGATGCTGGCAATTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178553.2-1264s1c1
Sequence:CCGGCGTGGAGTATCCTATATGCCTCTCGAGAGGCATATAGGATACTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178553
C2orf53 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 53
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-1779s21c1
Sequence:CCGGCAGTTTCTCTGGAGCTCATTCCTCGAGGAATGAGCTCCAGAGAAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-1315s21c1
Sequence:CCGGAGTCGTGGAGTATCCTATATGCTCGAGCATATAGGATACTCCACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-1076s21c1
Sequence:CCGGTCTCATAGGCTCCACTCTAACCTCGAGGTTAGAGTGGAGCCTATGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-797s21c1
Sequence:CCGGTTCGGCTCTTGTGACTCAAATCTCGAGATTTGAGTCACAAGAGCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178553.3-822s21c1
Sequence:CCGGACTTTGCTCCACATCCCTATTCTCGAGAATAGGGATGTGGAGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178553.2-594s1c1
Sequence:CCGGGCTTCTCACAACTTGTGGACTCTCGAGAGTCCACAAGTTGTGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178553.2-1522s1c1
Sequence:CCGGGCATCAATTGCCAGCATCTCACTCGAGTGAGATGCTGGCAATTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172310    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178553.2-1264s1c1
Sequence:CCGGCGTGGAGTATCCTATATGCCTCTCGAGAGGCATATAGGATACTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)