EMAIL THIS PAGE TO A FRIEND

C2orf54

chromosome 2 open reading frame 54

30 Gene Product Result for
UniProtKB ID: Q08AI8, B3KPP9, Q08AI9, Q53QU5, Q9H622
Gene ID:
chicken(770366) chromosome 9 open reading frame, human C2orf54
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024861 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085437 Rosetta Predictions human pricing
NM_024861 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317715 predicted 1834
2 SASI_Hs02_00317716 predicted 1325
3 SASI_Hs02_00317717 predicted 1011
4 SASI_Hs02_00317718 predicted 1437
5 SASI_Hs02_00317719 predicted 1832
6 SASI_Hs02_00317720 predicted 1449
7 SASI_Hs02_00317721 predicted 946
8 SASI_Hs02_00317722 predicted 987
9 SASI_Hs02_00317723 predicted 1637
10 SASI_Hs02_00317724 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357443 predicted 1262
2 SASI_Hs02_00357444 predicted 757
3 SASI_Hs02_00357445 predicted 453
4 SASI_Hs01_00139525 predicted 867
5 SASI_Hs02_00357446 predicted 1260
6 SASI_Hs01_00139526 predicted 879
7 SASI_Hs01_00139529 predicted 382
8 SASI_Hs01_00139531 predicted 421
9 SASI_Hs01_00139532 predicted 1069
10 SASI_Hs02_00357447 predicted 549
11 SASI_Hs01_00139523 predicted 1275
12 SASI_Hs01_00139524 predicted 462
13 SASI_Hs01_00139527 predicted 798
14 SASI_Hs01_00139528 predicted 1267
15 SASI_Hs01_00139530 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024861
C2orf54 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 54
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024861.1-1476s1c1
Sequence:CCGGCCTACCTCGTTCTTAGAGCAACTCGAGTTGCTCTAAGAACGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024861.1-1401s1c1
Sequence:CCGGGCTCATGTGCTGATGGATAATCTCGAGATTATCCATCAGCACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024861.1-847s1c1
Sequence:CCGGCAGGTCTTCAACATCCAGGATCTCGAGATCCTGGATGTTGAAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024861.1-273s1c1
Sequence:CCGGCTTGAGAAGAATCCTCAGCCACTCGAGTGGCTGAGGATTCTTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024861.1-174s1c1
Sequence:CCGGGAGAACAATCAGCTTCCACGTCTCGAGACGTGGAAGCTGATTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165550    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024861.1-1321s1c1
Sequence:CCGGGCTGGGTATACACAGCAGAAACTCGAGTTTCTGCTGTGTATACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024861.2-1269s21c1
Sequence:CCGGGCCATTCCTTGGTGACGAAATCTCGAGATTTCGTCACCAAGGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024861.2-1197s21c1
Sequence:CCGGACGTGGTGTTGTCAAGCAAACCTCGAGGTTTGCTTGACAACACCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024861
C2orf54 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 54
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024861.1-1476s1c1
Sequence:CCGGCCTACCTCGTTCTTAGAGCAACTCGAGTTGCTCTAAGAACGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024861.1-1401s1c1
Sequence:CCGGGCTCATGTGCTGATGGATAATCTCGAGATTATCCATCAGCACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024861.1-847s1c1
Sequence:CCGGCAGGTCTTCAACATCCAGGATCTCGAGATCCTGGATGTTGAAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024861.1-273s1c1
Sequence:CCGGCTTGAGAAGAATCCTCAGCCACTCGAGTGGCTGAGGATTCTTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024861.1-174s1c1
Sequence:CCGGGAGAACAATCAGCTTCCACGTCTCGAGACGTGGAAGCTGATTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165550    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024861.1-1321s1c1
Sequence:CCGGGCTGGGTATACACAGCAGAAACTCGAGTTTCTGCTGTGTATACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024861.2-1269s21c1
Sequence:CCGGGCCATTCCTTGGTGACGAAATCTCGAGATTTCGTCACCAAGGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024861.2-1197s21c1
Sequence:CCGGACGTGGTGTTGTCAAGCAAACCTCGAGGTTTGCTTGACAACACCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024861
C2orf54 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 54
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024861.1-1476s1c1
Sequence:CCGGCCTACCTCGTTCTTAGAGCAACTCGAGTTGCTCTAAGAACGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024861.1-1401s1c1
Sequence:CCGGGCTCATGTGCTGATGGATAATCTCGAGATTATCCATCAGCACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024861.1-847s1c1
Sequence:CCGGCAGGTCTTCAACATCCAGGATCTCGAGATCCTGGATGTTGAAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024861.1-273s1c1
Sequence:CCGGCTTGAGAAGAATCCTCAGCCACTCGAGTGGCTGAGGATTCTTCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024861.1-174s1c1
Sequence:CCGGGAGAACAATCAGCTTCCACGTCTCGAGACGTGGAAGCTGATTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165550    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024861.1-1321s1c1
Sequence:CCGGGCTGGGTATACACAGCAGAAACTCGAGTTTCTGCTGTGTATACCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024861.2-1269s21c1
Sequence:CCGGGCCATTCCTTGGTGACGAAATCTCGAGATTTCGTCACCAAGGAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024861.2-1197s21c1
Sequence:CCGGACGTGGTGTTGTCAAGCAAACCTCGAGGTTTGCTTGACAACACCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks