EMAIL THIS PAGE TO A FRIEND

C2orf57

chromosome 2 open reading frame 57

39 Gene Product Result for
Species: Human C2orf57(165100)
UniProtKB ID: Q53QW1, Q8N4F2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152614 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018031 MISSION® esiRNA esiRNA targeting human C2orf57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152614 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131337 predicted 620
2 SASI_Hs01_00131338 predicted 379
3 SASI_Hs01_00131339 predicted 375
4 SASI_Hs01_00131340 predicted 712
5 SASI_Hs01_00131341 predicted 399
6 SASI_Hs01_00131342 predicted 833
7 SASI_Hs01_00131344 predicted 335
8 SASI_Hs01_00131345 predicted 423
9 SASI_Hs02_00366466 predicted 977
10 SASI_Hs02_00366467 predicted 341
11 SASI_Hs01_00131343 predicted 437
12 SASI_Hs01_00131346 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152614
C2orf57 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 57
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152614.1-440s1c1
Sequence:CCGGGTAAAGACAAGATGTCACAAACTCGAGTTTGTGACATCTTGTCTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152614.1-252s1c1
Sequence:CCGGCAAAGACAAGAGTGCAGTTGTCTCGAGACAACTGCACTCTTGTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152614.1-450s1c1
Sequence:CCGGGATGTCACAAATGGCGAGTGTCTCGAGACACTCGCCATTTGTGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152614.1-670s1c1
Sequence:CCGGGCTGAAGCTTTACCATCTGATCTCGAGATCAGATGGTAAAGCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152614.1-234s1c1
Sequence:CCGGCATATCAACATCTGGAGACAACTCGAGTTGTCTCCAGATGTTGATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152614.1-665s1c1
Sequence:CCGGCTGAAGCTGAAGCTTTACCATCTCGAGATGGTAAAGCTTCAGCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152614
C2orf57 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 57
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152614.1-440s1c1
Sequence:CCGGGTAAAGACAAGATGTCACAAACTCGAGTTTGTGACATCTTGTCTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152614.1-252s1c1
Sequence:CCGGCAAAGACAAGAGTGCAGTTGTCTCGAGACAACTGCACTCTTGTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152614.1-450s1c1
Sequence:CCGGGATGTCACAAATGGCGAGTGTCTCGAGACACTCGCCATTTGTGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152614.1-670s1c1
Sequence:CCGGGCTGAAGCTTTACCATCTGATCTCGAGATCAGATGGTAAAGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152614.1-234s1c1
Sequence:CCGGCATATCAACATCTGGAGACAACTCGAGTTGTCTCCAGATGTTGATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152614.1-665s1c1
Sequence:CCGGCTGAAGCTGAAGCTTTACCATCTCGAGATGGTAAAGCTTCAGCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152614
C2orf57 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 57
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152614.1-440s1c1
Sequence:CCGGGTAAAGACAAGATGTCACAAACTCGAGTTTGTGACATCTTGTCTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152614.1-252s1c1
Sequence:CCGGCAAAGACAAGAGTGCAGTTGTCTCGAGACAACTGCACTCTTGTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180801    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152614.1-450s1c1
Sequence:CCGGGATGTCACAAATGGCGAGTGTCTCGAGACACTCGCCATTTGTGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152614.1-670s1c1
Sequence:CCGGGCTGAAGCTTTACCATCTGATCTCGAGATCAGATGGTAAAGCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152614.1-234s1c1
Sequence:CCGGCATATCAACATCTGGAGACAACTCGAGTTGTCTCCAGATGTTGATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152614.1-665s1c1
Sequence:CCGGCTGAAGCTGAAGCTTTACCATCTCGAGATGGTAAAGCTTCAGCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)