EMAIL THIS PAGE TO A FRIEND

C2orf61

chromosome 2 open reading frame 61

21 Gene Product Result for
Species: Human C2orf61(285051)
UniProtKB ID: Q8N801
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173649 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014681 MISSION® esiRNA esiRNA targeting human C2orf61 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173649 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034895 predicted 229
2 SASI_Hs01_00034896 predicted 365
3 SASI_Hs01_00034898 predicted 293
4 SASI_Hs01_00034899 predicted 233
5 SASI_Hs01_00034900 predicted 362
6 SASI_Hs01_00034901 predicted 366
7 SASI_Hs01_00034902 predicted 207
8 SASI_Hs01_00034903 predicted 310
9 SASI_Hs01_00034904 predicted 360
10 SASI_Hs02_00368553 predicted 217
11 SASI_Hs01_00034897 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173649
C2orf61 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 61
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173649.1-95s1c1
Sequence:CCGGGAGAATCATTCATCACAGCTTCTCGAGAAGCTGTGATGAATGATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173649.1-518s1c1
Sequence:CCGGCAACAGTTCAAAGATTCCCAACTCGAGTTGGGAATCTTTGAACTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173649.1-673s1c1
Sequence:CCGGGAACACCATTATCCACACAATCTCGAGATTGTGTGGATAATGGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173649.1-312s1c1
Sequence:CCGGCCTAAATGATCTTCCGCAGTACTCGAGTACTGCGGAAGATCATTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173649.1-366s1c1
Sequence:CCGGGCAAGTGGCTACTTACTCATTCTCGAGAATGAGTAAGTAGCCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173649.1-1503s1c1
Sequence:CCGGCCTACTGACTAAAGAGCCCTTCTCGAGAAGGGCTCTTTAGTCAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173649.1-1171s1c1
Sequence:CCGGCAGTGGACTTAGGGTACACAACTCGAGTTGTGTACCCTAAGTCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173649
C2orf61 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 61
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173649.1-95s1c1
Sequence:CCGGGAGAATCATTCATCACAGCTTCTCGAGAAGCTGTGATGAATGATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173649.1-518s1c1
Sequence:CCGGCAACAGTTCAAAGATTCCCAACTCGAGTTGGGAATCTTTGAACTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173649.1-673s1c1
Sequence:CCGGGAACACCATTATCCACACAATCTCGAGATTGTGTGGATAATGGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173649.1-312s1c1
Sequence:CCGGCCTAAATGATCTTCCGCAGTACTCGAGTACTGCGGAAGATCATTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173649.1-366s1c1
Sequence:CCGGGCAAGTGGCTACTTACTCATTCTCGAGAATGAGTAAGTAGCCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173649.1-1503s1c1
Sequence:CCGGCCTACTGACTAAAGAGCCCTTCTCGAGAAGGGCTCTTTAGTCAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173649.1-1171s1c1
Sequence:CCGGCAGTGGACTTAGGGTACACAACTCGAGTTGTGTACCCTAAGTCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173649
C2orf61 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 61
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173649.1-95s1c1
Sequence:CCGGGAGAATCATTCATCACAGCTTCTCGAGAAGCTGTGATGAATGATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173649.1-518s1c1
Sequence:CCGGCAACAGTTCAAAGATTCCCAACTCGAGTTGGGAATCTTTGAACTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173649.1-673s1c1
Sequence:CCGGGAACACCATTATCCACACAATCTCGAGATTGTGTGGATAATGGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173649.1-312s1c1
Sequence:CCGGCCTAAATGATCTTCCGCAGTACTCGAGTACTGCGGAAGATCATTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173649.1-366s1c1
Sequence:CCGGGCAAGTGGCTACTTACTCATTCTCGAGAATGAGTAAGTAGCCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173649.1-1503s1c1
Sequence:CCGGCCTACTGACTAAAGAGCCCTTCTCGAGAAGGGCTCTTTAGTCAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173649.1-1171s1c1
Sequence:CCGGCAGTGGACTTAGGGTACACAACTCGAGTTGTGTACCCTAAGTCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)