EMAIL THIS PAGE TO A FRIEND

C2orf62

chromosome 2 open reading frame 62

UniProtKB ID: Q7Z7H3
Gene ID:
chicken(426213) chromosome unknown open reading frame, human C2orf62
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198559 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010291 MISSION® esiRNA esiRNA targeting human C2orf62 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198559 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038524 predicted 684
2 SASI_Hs01_00038525 predicted 750
3 SASI_Hs01_00038526 predicted 1058
4 SASI_Hs01_00038528 predicted 907
5 SASI_Hs01_00038529 predicted 898
6 SASI_Hs01_00038530 predicted 1053
7 SASI_Hs01_00038531 predicted 911
8 SASI_Hs01_00038532 predicted 924
9 SASI_Hs02_00372173 predicted 914
10 SASI_Hs02_00372174 predicted 698
11 SASI_Hs01_00038523 predicted 971
12 SASI_Hs01_00038527 predicted 903
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198559
C2orf62 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 62
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198559.1-524s1c1
Sequence:CCGGGAGCTCAATCAAGGGCTTCATCTCGAGATGAAGCCCTTGATTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198559.1-632s1c1
Sequence:CCGGCGAGGGCAAACTCTGCTATTTCTCGAGAAATAGCAGAGTTTGCCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198559.1-848s1c1
Sequence:CCGGCTTGAGGGAAGAGGATGAGATCTCGAGATCTCATCCTCTTCCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198559.1-638s1c1
Sequence:CCGGCAAACTCTGCTATTTGACCTACTCGAGTAGGTCAAATAGCAGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-303s21c1
Sequence:CCGGAGCCGAGGCTTCTTGGACAAACTCGAGTTTGTCCAAGAAGCCTCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-277s21c1
Sequence:CCGGCATACTGCCTCTTCGTGCATGCTCGAGCATGCACGAAGAGGCAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-232s21c1
Sequence:CCGGTTGAGGTGCAGAGAGGGAAATCTCGAGATTTCCCTCTCTGCACCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-381s21c1
Sequence:CCGGCAGCACAGCCAAGACTTCATCCTCGAGGATGAAGTCTTGGCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-917s21c1
Sequence:CCGGTATGGAGCTCTATTCGAAGTTCTCGAGAACTTCGAATAGAGCTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-113s21c1
Sequence:CCGGCAATGCTGAAGCCATCGACTTCTCGAGAAGTCGATGGCTTCAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198559
C2orf62 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 62
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198559.1-524s1c1
Sequence:CCGGGAGCTCAATCAAGGGCTTCATCTCGAGATGAAGCCCTTGATTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198559.1-632s1c1
Sequence:CCGGCGAGGGCAAACTCTGCTATTTCTCGAGAAATAGCAGAGTTTGCCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198559.1-848s1c1
Sequence:CCGGCTTGAGGGAAGAGGATGAGATCTCGAGATCTCATCCTCTTCCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198559.1-638s1c1
Sequence:CCGGCAAACTCTGCTATTTGACCTACTCGAGTAGGTCAAATAGCAGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-303s21c1
Sequence:CCGGAGCCGAGGCTTCTTGGACAAACTCGAGTTTGTCCAAGAAGCCTCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-277s21c1
Sequence:CCGGCATACTGCCTCTTCGTGCATGCTCGAGCATGCACGAAGAGGCAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-232s21c1
Sequence:CCGGTTGAGGTGCAGAGAGGGAAATCTCGAGATTTCCCTCTCTGCACCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-381s21c1
Sequence:CCGGCAGCACAGCCAAGACTTCATCCTCGAGGATGAAGTCTTGGCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-917s21c1
Sequence:CCGGTATGGAGCTCTATTCGAAGTTCTCGAGAACTTCGAATAGAGCTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-113s21c1
Sequence:CCGGCAATGCTGAAGCCATCGACTTCTCGAGAAGTCGATGGCTTCAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198559
C2orf62 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 62
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198559.1-524s1c1
Sequence:CCGGGAGCTCAATCAAGGGCTTCATCTCGAGATGAAGCCCTTGATTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198559.1-632s1c1
Sequence:CCGGCGAGGGCAAACTCTGCTATTTCTCGAGAAATAGCAGAGTTTGCCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198559.1-848s1c1
Sequence:CCGGCTTGAGGGAAGAGGATGAGATCTCGAGATCTCATCCTCTTCCCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198559.1-638s1c1
Sequence:CCGGCAAACTCTGCTATTTGACCTACTCGAGTAGGTCAAATAGCAGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-303s21c1
Sequence:CCGGAGCCGAGGCTTCTTGGACAAACTCGAGTTTGTCCAAGAAGCCTCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-277s21c1
Sequence:CCGGCATACTGCCTCTTCGTGCATGCTCGAGCATGCACGAAGAGGCAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-232s21c1
Sequence:CCGGTTGAGGTGCAGAGAGGGAAATCTCGAGATTTCCCTCTCTGCACCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-381s21c1
Sequence:CCGGCAGCACAGCCAAGACTTCATCCTCGAGGATGAAGTCTTGGCTGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-917s21c1
Sequence:CCGGTATGGAGCTCTATTCGAAGTTCTCGAGAACTTCGAATAGAGCTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198559.1-113s21c1
Sequence:CCGGCAATGCTGAAGCCATCGACTTCTCGAGAAGTCGATGGCTTCAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks