EMAIL THIS PAGE TO A FRIEND

C2orf66

chromosome 2 open reading frame 66

20 Gene Product Result for
Synonyms: UNQ6411
Species: Human C2orf66(401027)
UniProtKB ID: Q6UXQ4, B2RNW3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_213608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_213608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_213608 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145031 MISSION® esiRNA esiRNA human C2orf66 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213608 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191256 predicted 981
2 SASI_Hs01_00191257 predicted 1093
3 SASI_Hs02_00374292 predicted 1092
4 SASI_Hs02_00374293 predicted 1154
5 SASI_Hs01_00191258 predicted 1098
6 SASI_Hs02_00374294 predicted 1156
7 SASI_Hs01_00191259 predicted 979
8 SASI_Hs01_00191260 predicted 951
9 SASI_Hs01_00191261 predicted 924
10 SASI_Hs01_00191262 predicted 941
11 SASI_Hs01_00191263 predicted 1043
12 SASI_Hs01_00191264 predicted 944
13 SASI_Hs01_00191265 predicted 1153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213608
C2orf66 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 66
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213608.1-1159s21c1
Sequence:CCGGCTCTTTCCAGTCAGAACTTACCTCGAGGTAAGTTCTGACTGGAAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213608.1-1092s21c1
Sequence:CCGGAGGGCAGAGGTCTTGATCTTGCTCGAGCAAGATCAAGACCTCTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213608.1-949s21c1
Sequence:CCGGAGCACCTCTCCTGCTACTATGCTCGAGCATAGTAGCAGGAGAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-997s1c1
Sequence:CCGGGAATGGAGCCACAGTAAGAAACTCGAGTTTCTTACTGTGGCTCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-1046s1c1
Sequence:CCGGCCCAGAAACAGAGATCTGTTTCTCGAGAAACAGATCTCTGTTTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-1024s1c1
Sequence:CCGGCAAATGGAAGCCACTCAACAACTCGAGTTGTTGAGTGGCTTCCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213608.1-1170s1c1
Sequence:CCGGCAGAACTTACTGCTTCTGCATCTCGAGATGCAGAAGCAGTAAGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-1193s1c1
Sequence:CCGGGCAGATTATGAAGAGCAGAAACTCGAGTTTCTGCTCTTCATAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-1069s1c1
Sequence:CCGGCAGAAGGCTTCAGGCATATTTCTCGAGAAATATGCCTGAAGCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213608
C2orf66 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 66
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213608.1-1159s21c1
Sequence:CCGGCTCTTTCCAGTCAGAACTTACCTCGAGGTAAGTTCTGACTGGAAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213608.1-1092s21c1
Sequence:CCGGAGGGCAGAGGTCTTGATCTTGCTCGAGCAAGATCAAGACCTCTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213608.1-949s21c1
Sequence:CCGGAGCACCTCTCCTGCTACTATGCTCGAGCATAGTAGCAGGAGAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-997s1c1
Sequence:CCGGGAATGGAGCCACAGTAAGAAACTCGAGTTTCTTACTGTGGCTCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-1046s1c1
Sequence:CCGGCCCAGAAACAGAGATCTGTTTCTCGAGAAACAGATCTCTGTTTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-1024s1c1
Sequence:CCGGCAAATGGAAGCCACTCAACAACTCGAGTTGTTGAGTGGCTTCCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213608.1-1170s1c1
Sequence:CCGGCAGAACTTACTGCTTCTGCATCTCGAGATGCAGAAGCAGTAAGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-1193s1c1
Sequence:CCGGGCAGATTATGAAGAGCAGAAACTCGAGTTTCTGCTCTTCATAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-1069s1c1
Sequence:CCGGCAGAAGGCTTCAGGCATATTTCTCGAGAAATATGCCTGAAGCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213608
C2orf66 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 66
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213608.1-1159s21c1
Sequence:CCGGCTCTTTCCAGTCAGAACTTACCTCGAGGTAAGTTCTGACTGGAAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213608.1-1092s21c1
Sequence:CCGGAGGGCAGAGGTCTTGATCTTGCTCGAGCAAGATCAAGACCTCTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213608.1-949s21c1
Sequence:CCGGAGCACCTCTCCTGCTACTATGCTCGAGCATAGTAGCAGGAGAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-997s1c1
Sequence:CCGGGAATGGAGCCACAGTAAGAAACTCGAGTTTCTTACTGTGGCTCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-1046s1c1
Sequence:CCGGCCCAGAAACAGAGATCTGTTTCTCGAGAAACAGATCTCTGTTTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-1024s1c1
Sequence:CCGGCAAATGGAAGCCACTCAACAACTCGAGTTGTTGAGTGGCTTCCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_213608.1-1170s1c1
Sequence:CCGGCAGAACTTACTGCTTCTGCATCTCGAGATGCAGAAGCAGTAAGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-1193s1c1
Sequence:CCGGGCAGATTATGAAGAGCAGAAACTCGAGTTTCTGCTCTTCATAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213608.1-1069s1c1
Sequence:CCGGCAGAAGGCTTCAGGCATATTTCTCGAGAAATATGCCTGAAGCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)