EMAIL THIS PAGE TO A FRIEND

C2orf68

chromosome 2 open reading frame 68

22 Gene Product Result for
Synonyms: HCRCN81
Species: Human C2orf68(388969)
UniProtKB ID: Q2NKX9, B4DT10, Q4G0J7, Q6ZVA6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013649 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055811 MISSION® esiRNA esiRNA human C2orf68 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013649 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013860 predicted 587
2 SASI_Hs01_00013861 predicted 355
3 SASI_Hs01_00013862 predicted 538
4 SASI_Hs01_00013863 predicted 1032
5 SASI_Hs02_00306419 predicted 953
6 SASI_Hs01_00013865 predicted 914
7 SASI_Hs01_00013866 predicted 391
8 SASI_Hs02_00306420 predicted 385
9 SASI_Hs02_00306421 predicted 386
10 SASI_Hs01_00013867 predicted 279
11 SASI_Hs01_00013864 predicted 570
12 SASI_Hs01_00013868 predicted 797
13 SASI_Hs01_00013869 predicted 430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013649
VALIDATED
C2orf68 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 68
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001013649.1-369s1c1
Sequence:CCGGGTTCAGCTCATCTCGTCTCTTCTCGAGAAGAGACGAGATGAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013649.1-655s1c1
Sequence:CCGGCCTAGAGATCACACTGGTTAACTCGAGTTAACCAGTGTGATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162966    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013649.1-1571s1c1
Sequence:CCGGGCAGGGATGCAAAGGTAAATACTCGAGTATTTACCTTTGCATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013649.1-159s1c1
Sequence:CCGGCGACTATGACAAGAAGGTGAACTCGAGTTCACCTTCTTGTCATAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013649.1-351s1c1
Sequence:CCGGCCACTTCTTACTCCTAAGGTTCTCGAGAACCTTAGGAGTAAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013649.3-760s21c1
Sequence:CCGGCATTTGCCCAGCCTGATATTCCTCGAGGAATATCAGGCTGGGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013649.3-602s21c1
Sequence:CCCGGATTCACTGCACTCGGAAGAACTCGAGTTCTTCCGAGTGCAGTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013649.3-428s21c1
Sequence:CCGGTCACATCAGTTATCGTCTATCCTCGAGGATAGACGATAACTGATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013649.3-943s21c1
Sequence:CCGGGCTCCATGAGCCACGTTTGTTCTCGAGAACAAACGTGGCTCATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013649
VALIDATED
C2orf68 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 68
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001013649.1-369s1c1
Sequence:CCGGGTTCAGCTCATCTCGTCTCTTCTCGAGAAGAGACGAGATGAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013649.1-655s1c1
Sequence:CCGGCCTAGAGATCACACTGGTTAACTCGAGTTAACCAGTGTGATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162966    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013649.1-1571s1c1
Sequence:CCGGGCAGGGATGCAAAGGTAAATACTCGAGTATTTACCTTTGCATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013649.1-159s1c1
Sequence:CCGGCGACTATGACAAGAAGGTGAACTCGAGTTCACCTTCTTGTCATAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013649.1-351s1c1
Sequence:CCGGCCACTTCTTACTCCTAAGGTTCTCGAGAACCTTAGGAGTAAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013649.3-760s21c1
Sequence:CCGGCATTTGCCCAGCCTGATATTCCTCGAGGAATATCAGGCTGGGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013649.3-602s21c1
Sequence:CCCGGATTCACTGCACTCGGAAGAACTCGAGTTCTTCCGAGTGCAGTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013649.3-428s21c1
Sequence:CCGGTCACATCAGTTATCGTCTATCCTCGAGGATAGACGATAACTGATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013649.3-943s21c1
Sequence:CCGGGCTCCATGAGCCACGTTTGTTCTCGAGAACAAACGTGGCTCATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013649
VALIDATED
C2orf68 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 68
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001013649.1-369s1c1
Sequence:CCGGGTTCAGCTCATCTCGTCTCTTCTCGAGAAGAGACGAGATGAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164151    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013649.1-655s1c1
Sequence:CCGGCCTAGAGATCACACTGGTTAACTCGAGTTAACCAGTGTGATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162966    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013649.1-1571s1c1
Sequence:CCGGGCAGGGATGCAAAGGTAAATACTCGAGTATTTACCTTTGCATCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013649.1-159s1c1
Sequence:CCGGCGACTATGACAAGAAGGTGAACTCGAGTTCACCTTCTTGTCATAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013649.1-351s1c1
Sequence:CCGGCCACTTCTTACTCCTAAGGTTCTCGAGAACCTTAGGAGTAAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013649.3-760s21c1
Sequence:CCGGCATTTGCCCAGCCTGATATTCCTCGAGGAATATCAGGCTGGGCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013649.3-602s21c1
Sequence:CCCGGATTCACTGCACTCGGAAGAACTCGAGTTCTTCCGAGTGCAGTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013649.3-428s21c1
Sequence:CCGGTCACATCAGTTATCGTCTATCCTCGAGGATAGACGATAACTGATGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013649.3-943s21c1
Sequence:CCGGGCTCCATGAGCCACGTTTGTTCTCGAGAACAAACGTGGCTCATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks