EMAIL THIS PAGE TO A FRIEND

C2orf69

chromosome 2 open reading frame 69

114 Gene Product Result for
Species: Human C2orf69(205327)
UniProtKB ID: Q8N8R5, Q8NE30
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153689 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006391 MISSION® esiRNA esiRNA targeting human C2orf69 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153689 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191316 predicted 813
2 SASI_Hs01_00191317 predicted 1039
3 SASI_Hs01_00191318 predicted 494
4 SASI_Hs01_00191319 predicted 775
5 SASI_Hs01_00191320 predicted 1029
6 SASI_Hs01_00191321 predicted 1142
7 SASI_Hs01_00191322 predicted 908
8 SASI_Hs01_00191323 predicted 1293
9 SASI_Hs01_00191325 predicted 1201
10 SASI_Hs02_00367402 predicted 767
11 SASI_Hs01_00191324 predicted 1062
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153689
C2orf69 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 69
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153689.3-1218s1c1
Sequence:CCGGGCAGGTGACTAGCCAAATTCACTCGAGTGAATTTGGCTAGTCACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153689.3-763s1c1
Sequence:CCGGGTTTGGAATAAGGACTCCATACTCGAGTATGGAGTCCTTATTCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135552    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153689.3-2305s1c1
Sequence:CCGGGCTCTATTTGTTAGAGCTCTACTCGAGTAGAGCTCTAACAAATAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153689.3-1546s1c1
Sequence:CCGGGAGGAGATATAAGACCCTTAACTCGAGTTAAGGGTCTTATATCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153689.3-1055s1c1
Sequence:CCGGGAAGCAATACTTGGGTTACTTCTCGAGAAGTAACCCAAGTATTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153689.3-1135s1c1
Sequence:CCGGCCTTACCAAGTACGTGATCCACTCGAGTGGATCACGTACTTGGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153689.3-1462s1c1
Sequence:CCGGGCTTGTGAATGTGAGCAGTTACTCGAGTAACTGCTCACATTCACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153689.3-788s1c1
Sequence:CCGGCTAACTGTAGATCCAGTCCTTCTCGAGAAGGACTGGATCTACAGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153689.3-779s1c1
Sequence:CCGGCCATAGCATCTAACTGTAGATCTCGAGATCTACAGTTAGATGCTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153689.3-1052s1c1
Sequence:CCGGGAGGAAGCAATACTTGGGTTACTCGAGTAACCCAAGTATTGCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153689
C2orf69 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 69
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153689.3-1218s1c1
Sequence:CCGGGCAGGTGACTAGCCAAATTCACTCGAGTGAATTTGGCTAGTCACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153689.3-763s1c1
Sequence:CCGGGTTTGGAATAAGGACTCCATACTCGAGTATGGAGTCCTTATTCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135552    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153689.3-2305s1c1
Sequence:CCGGGCTCTATTTGTTAGAGCTCTACTCGAGTAGAGCTCTAACAAATAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153689.3-1546s1c1
Sequence:CCGGGAGGAGATATAAGACCCTTAACTCGAGTTAAGGGTCTTATATCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153689.3-1055s1c1
Sequence:CCGGGAAGCAATACTTGGGTTACTTCTCGAGAAGTAACCCAAGTATTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153689.3-1135s1c1
Sequence:CCGGCCTTACCAAGTACGTGATCCACTCGAGTGGATCACGTACTTGGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153689.3-1462s1c1
Sequence:CCGGGCTTGTGAATGTGAGCAGTTACTCGAGTAACTGCTCACATTCACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153689.3-788s1c1
Sequence:CCGGCTAACTGTAGATCCAGTCCTTCTCGAGAAGGACTGGATCTACAGTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153689.3-779s1c1
Sequence:CCGGCCATAGCATCTAACTGTAGATCTCGAGATCTACAGTTAGATGCTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153689.3-1052s1c1
Sequence:CCGGGAGGAAGCAATACTTGGGTTACTCGAGTAACCCAAGTATTGCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153689
C2orf69 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 69
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153689.3-1218s1c1
Sequence:CCGGGCAGGTGACTAGCCAAATTCACTCGAGTGAATTTGGCTAGTCACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153689.3-763s1c1
Sequence:CCGGGTTTGGAATAAGGACTCCATACTCGAGTATGGAGTCCTTATTCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135552    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153689.3-2305s1c1
Sequence:CCGGGCTCTATTTGTTAGAGCTCTACTCGAGTAGAGCTCTAACAAATAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153689.3-1546s1c1
Sequence:CCGGGAGGAGATATAAGACCCTTAACTCGAGTTAAGGGTCTTATATCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153689.3-1055s1c1
Sequence:CCGGGAAGCAATACTTGGGTTACTTCTCGAGAAGTAACCCAAGTATTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153689.3-1135s1c1
Sequence:CCGGCCTTACCAAGTACGTGATCCACTCGAGTGGATCACGTACTTGGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137401    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153689.3-1462s1c1
Sequence:CCGGGCTTGTGAATGTGAGCAGTTACTCGAGTAACTGCTCACATTCACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153689.3-788s1c1
Sequence:CCGGCTAACTGTAGATCCAGTCCTTCTCGAGAAGGACTGGATCTACAGTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153689.3-779s1c1
Sequence:CCGGCCATAGCATCTAACTGTAGATCTCGAGATCTACAGTTAGATGCTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153689.3-1052s1c1
Sequence:CCGGGAGGAAGCAATACTTGGGTTACTCGAGTAACCCAAGTATTGCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)