EMAIL THIS PAGE TO A FRIEND

C2orf70

chromosome 2 open reading frame 70

28 Gene Product Result for
Species: Human C2orf70(339778)
UniProtKB ID: A6NJV1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001105519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105519 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125491 MISSION® esiRNA esiRNA human C2orf70 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105519 Rosetta Predictions human pricing
XM_496547 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324169 predicted 314
2 SASI_Hs02_00324170 predicted 283
3 SASI_Hs02_00324171 predicted 317
4 SASI_Hs02_00324172 predicted 319
5 SASI_Hs02_00324173 predicted 355
6 SASI_Hs02_00324174 predicted 455
7 SASI_Hs02_00324175 predicted 310
8 SASI_Hs02_00324176 predicted 323
9 SASI_Hs02_00324177 predicted 286
10 SASI_Hs02_00324178 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254075 predicted 802
2 SASI_Hs01_00254076 predicted 957
3 SASI_Hs01_00254077 predicted 1190
4 SASI_Hs01_00254078 predicted 219
5 SASI_Hs01_00254079 predicted 1403
6 SASI_Hs01_00254080 predicted 387
7 SASI_Hs01_00254081 predicted 841
8 SASI_Hs01_00254082 predicted 1027
9 SASI_Hs01_00254083 predicted 1394
10 SASI_Hs01_00254084 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105519
C2orf70 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 70
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-127s21c1
Sequence:CCGGACCACCACCCTCAAGTACTTCCTCGAGGAAGTACTTGAGGGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-476s21c1
Sequence:CCGGCAAAGAAGAAGTGGCACCTTTCTCGAGAAAGGTGCCACTTCTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-356s21c1
Sequence:CCGGAGCAGCATCGGAAGTACTATCCTCGAGGATAGTACTTCCGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-321s21c1
Sequence:CCGGCTCCACAGAGCTTACGAATTTCTCGAGAAATTCGTAAGCTCTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-517s21c1
Sequence:CCGGCTGAAGACCTACCAGACCTTCCTCGAGGAAGGTCTGGTAGGTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105519
C2orf70 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 70
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-127s21c1
Sequence:CCGGACCACCACCCTCAAGTACTTCCTCGAGGAAGTACTTGAGGGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-476s21c1
Sequence:CCGGCAAAGAAGAAGTGGCACCTTTCTCGAGAAAGGTGCCACTTCTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-356s21c1
Sequence:CCGGAGCAGCATCGGAAGTACTATCCTCGAGGATAGTACTTCCGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-321s21c1
Sequence:CCGGCTCCACAGAGCTTACGAATTTCTCGAGAAATTCGTAAGCTCTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-517s21c1
Sequence:CCGGCTGAAGACCTACCAGACCTTCCTCGAGGAAGGTCTGGTAGGTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105519
C2orf70 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 70
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-127s21c1
Sequence:CCGGACCACCACCCTCAAGTACTTCCTCGAGGAAGTACTTGAGGGTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-476s21c1
Sequence:CCGGCAAAGAAGAAGTGGCACCTTTCTCGAGAAAGGTGCCACTTCTTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-356s21c1
Sequence:CCGGAGCAGCATCGGAAGTACTATCCTCGAGGATAGTACTTCCGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-321s21c1
Sequence:CCGGCTCCACAGAGCTTACGAATTTCTCGAGAAATTCGTAAGCTCTGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105519.1-517s21c1
Sequence:CCGGCTGAAGACCTACCAGACCTTCCTCGAGGAAGGTCTGGTAGGTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks