EMAIL THIS PAGE TO A FRIEND

C2orf71

chromosome 2 open reading frame 71

73 Gene Product Result for
Species: Human C2orf71(388939)
UniProtKB ID: A6NGG8
Gene ID:
Human(388939) Summary: The protein encoded by this gene is highly expressed in photoreceptors and may associate with the primary cilium of the outer segment. The encoded protein appears to undergo post-translational lipid modification. Nonsense and missense variants of this gene appear to cause a recessive form of retinitis pigmentosa. [provided by RefSeq, Jun 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029883 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029883 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029883 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139571 MISSION® esiRNA esiRNA human C2orf71 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029883 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029883 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141488 predicted 1528
2 SASI_Hs01_00141489 predicted 1127
3 SASI_Hs01_00141490 predicted 1189
4 SASI_Hs01_00141493 predicted 2033
5 SASI_Hs01_00141494 predicted 1356
6 SASI_Hs01_00141495 predicted 2038
7 SASI_Hs01_00141496 predicted 2492
8 SASI_Hs01_00141497 predicted 591
9 SASI_Hs02_00307565 predicted 329
10 SASI_Hs02_00307566 predicted 3471
11 SASI_Hs01_00141491 predicted 581
12 SASI_Hs01_00141492 predicted 2190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029883
C2orf71 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 71
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029883.1-4516s1c1
Sequence:CCGGCCCTATTGAGAGCTTTGTTTACTCGAGTAAACAAAGCTCTCAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029883.1-1363s1c1
Sequence:CCGGCCATGTGATTCCTTTGGGATTCTCGAGAATCCCAAAGGAATCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029883.1-4688s1c1
Sequence:CCGGCGGCCTAAGCATGTAGCAAATCTCGAGATTTGCTACATGCTTAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-1424s1c1
Sequence:CCGGCGATGGACGCTTCATCTCTTACTCGAGTAAGAGATGAAGCGTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-195s1c1
Sequence:CCGGGAGGAACCAAACCACAGCTAACTCGAGTTAGCTGTGGTTTGGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-2394s1c1
Sequence:CCGGGAAGCCCTTAGCACCTATCTTCTCGAGAAGATAGGTGCTAAGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-810s1c1
Sequence:CCGGGCTACAGTACACAGTCAGCAACTCGAGTTGCTGACTGTGTACTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-1191s1c1
Sequence:CCGGGCAGCAAAGTCCATTCTGTTTCTCGAGAAACAGAATGGACTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029883.1-4471s1c1
Sequence:CCGGGCTTCTTTGTTGTAAGGTTAACTCGAGTTAACCTTACAACAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-2008s1c1
Sequence:CCGGCTCACCAAGAACTTCAGTATTCTCGAGAATACTGAAGTTCTTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029883.1-5045s1c1
Sequence:CCGGGCAGTAATTGAGTGATTCAATCTCGAGATTGAATCACTCAATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029883.1-417s1c1
Sequence:CCGGCCAAGATACTTCCAAATGGAACTCGAGTTCCATTTGGAAGTATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029883
C2orf71 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 71
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029883.1-4516s1c1
Sequence:CCGGCCCTATTGAGAGCTTTGTTTACTCGAGTAAACAAAGCTCTCAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029883.1-1363s1c1
Sequence:CCGGCCATGTGATTCCTTTGGGATTCTCGAGAATCCCAAAGGAATCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029883.1-4688s1c1
Sequence:CCGGCGGCCTAAGCATGTAGCAAATCTCGAGATTTGCTACATGCTTAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-1424s1c1
Sequence:CCGGCGATGGACGCTTCATCTCTTACTCGAGTAAGAGATGAAGCGTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-195s1c1
Sequence:CCGGGAGGAACCAAACCACAGCTAACTCGAGTTAGCTGTGGTTTGGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-2394s1c1
Sequence:CCGGGAAGCCCTTAGCACCTATCTTCTCGAGAAGATAGGTGCTAAGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-810s1c1
Sequence:CCGGGCTACAGTACACAGTCAGCAACTCGAGTTGCTGACTGTGTACTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-1191s1c1
Sequence:CCGGGCAGCAAAGTCCATTCTGTTTCTCGAGAAACAGAATGGACTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029883.1-4471s1c1
Sequence:CCGGGCTTCTTTGTTGTAAGGTTAACTCGAGTTAACCTTACAACAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-2008s1c1
Sequence:CCGGCTCACCAAGAACTTCAGTATTCTCGAGAATACTGAAGTTCTTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029883.1-5045s1c1
Sequence:CCGGGCAGTAATTGAGTGATTCAATCTCGAGATTGAATCACTCAATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029883.1-417s1c1
Sequence:CCGGCCAAGATACTTCCAAATGGAACTCGAGTTCCATTTGGAAGTATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029883
C2orf71 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 71
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143924    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001029883.1-4516s1c1
Sequence:CCGGCCCTATTGAGAGCTTTGTTTACTCGAGTAAACAAAGCTCTCAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029883.1-1363s1c1
Sequence:CCGGCCATGTGATTCCTTTGGGATTCTCGAGAATCCCAAAGGAATCACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029883.1-4688s1c1
Sequence:CCGGCGGCCTAAGCATGTAGCAAATCTCGAGATTTGCTACATGCTTAGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-1424s1c1
Sequence:CCGGCGATGGACGCTTCATCTCTTACTCGAGTAAGAGATGAAGCGTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-195s1c1
Sequence:CCGGGAGGAACCAAACCACAGCTAACTCGAGTTAGCTGTGGTTTGGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-2394s1c1
Sequence:CCGGGAAGCCCTTAGCACCTATCTTCTCGAGAAGATAGGTGCTAAGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-810s1c1
Sequence:CCGGGCTACAGTACACAGTCAGCAACTCGAGTTGCTGACTGTGTACTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-1191s1c1
Sequence:CCGGGCAGCAAAGTCCATTCTGTTTCTCGAGAAACAGAATGGACTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029883.1-4471s1c1
Sequence:CCGGGCTTCTTTGTTGTAAGGTTAACTCGAGTTAACCTTACAACAAAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001029883.1-2008s1c1
Sequence:CCGGCTCACCAAGAACTTCAGTATTCTCGAGAATACTGAAGTTCTTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029883.1-5045s1c1
Sequence:CCGGGCAGTAATTGAGTGATTCAATCTCGAGATTGAATCACTCAATTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029883.1-417s1c1
Sequence:CCGGCCAAGATACTTCCAAATGGAACTCGAGTTCCATTTGGAAGTATCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks