EMAIL THIS PAGE TO A FRIEND

C2orf73

chromosome 2 open reading frame 73

31 Gene Product Result for
Species: Human C2orf73(129852)
UniProtKB ID: Q8N5S3, A0AV79, A0AV81, Q8N7V4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173486 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173486 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173486 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074541 MISSION® esiRNA esiRNA human C2orf73 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100396 Rosetta Predictions human pricing
NM_173486 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321904 predicted 895
2 SASI_Hs02_00321905 predicted 787
3 SASI_Hs02_00321906 predicted 951
4 SASI_Hs02_00321907 predicted 598
5 SASI_Hs02_00321908 predicted 812
6 SASI_Hs02_00321909 predicted 584
7 SASI_Hs02_00321910 predicted 281
8 SASI_Hs02_00321911 predicted 423
9 SASI_Hs02_00321912 predicted 380
10 SASI_Hs02_00321913 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103517 predicted 726
2 SASI_Hs01_00103518 predicted 744
3 SASI_Hs01_00103519 predicted 668
4 SASI_Hs01_00103520 predicted 613
5 SASI_Hs01_00103521 predicted 322
6 SASI_Hs01_00103522 predicted 582
7 SASI_Hs01_00103523 predicted 387
8 SASI_Hs01_00103524 predicted 226
9 SASI_Hs01_00103525 predicted 418
10 SASI_Hs01_00103526 predicted 740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173486
C2orf73 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 73
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173486.1-459s1c1
Sequence:CCGGGAGAAAGGAAACTCAGCGGAACTCGAGTTCCGCTGAGTTTCCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121716    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173486.1-726s1c1
Sequence:CCGGCCCTGGAATATAGGGAAATTTCTCGAGAAATTTCCCTATATTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173486.1-241s1c1
Sequence:CCGGGTACATCAGCAGAACTTCAAACTCGAGTTTGAAGTTCTGCTGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173486.1-402s1c1
Sequence:CCGGGCAGAGGTATTACTGAACACTCTCGAGAGTGTTCAGTAATACCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173486.1-482s1c1
Sequence:CCGGCAGAATGATCTCACCAGGTCTCTCGAGAGACCTGGTGAGATCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173486.1-377s1c1
Sequence:CCGGCAGTAGGCCAACAGTTCCTAACTCGAGTTAGGAACTGTTGGCCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173486.1-519s1c1
Sequence:CCGGCAGGAGCTGTTAGAGCCTAAACTCGAGTTTAGGCTCTAACAGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173486.1-1445s1c1
Sequence:CCGGGCACCAACTCAACCTTTGCTTCTCGAGAAGCAAAGGTTGAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173486.1-589s1c1
Sequence:CCGGGCACTCTTGAGAGCAGAGAAACTCGAGTTTCTCTGCTCTCAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173486
C2orf73 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 73
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173486.1-459s1c1
Sequence:CCGGGAGAAAGGAAACTCAGCGGAACTCGAGTTCCGCTGAGTTTCCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121716    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173486.1-726s1c1
Sequence:CCGGCCCTGGAATATAGGGAAATTTCTCGAGAAATTTCCCTATATTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173486.1-241s1c1
Sequence:CCGGGTACATCAGCAGAACTTCAAACTCGAGTTTGAAGTTCTGCTGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173486.1-402s1c1
Sequence:CCGGGCAGAGGTATTACTGAACACTCTCGAGAGTGTTCAGTAATACCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173486.1-482s1c1
Sequence:CCGGCAGAATGATCTCACCAGGTCTCTCGAGAGACCTGGTGAGATCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173486.1-377s1c1
Sequence:CCGGCAGTAGGCCAACAGTTCCTAACTCGAGTTAGGAACTGTTGGCCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173486.1-519s1c1
Sequence:CCGGCAGGAGCTGTTAGAGCCTAAACTCGAGTTTAGGCTCTAACAGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173486.1-1445s1c1
Sequence:CCGGGCACCAACTCAACCTTTGCTTCTCGAGAAGCAAAGGTTGAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173486.1-589s1c1
Sequence:CCGGGCACTCTTGAGAGCAGAGAAACTCGAGTTTCTCTGCTCTCAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173486
C2orf73 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 73
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173486.1-459s1c1
Sequence:CCGGGAGAAAGGAAACTCAGCGGAACTCGAGTTCCGCTGAGTTTCCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121716    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173486.1-726s1c1
Sequence:CCGGCCCTGGAATATAGGGAAATTTCTCGAGAAATTTCCCTATATTCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173486.1-241s1c1
Sequence:CCGGGTACATCAGCAGAACTTCAAACTCGAGTTTGAAGTTCTGCTGATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173486.1-402s1c1
Sequence:CCGGGCAGAGGTATTACTGAACACTCTCGAGAGTGTTCAGTAATACCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173486.1-482s1c1
Sequence:CCGGCAGAATGATCTCACCAGGTCTCTCGAGAGACCTGGTGAGATCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173486.1-377s1c1
Sequence:CCGGCAGTAGGCCAACAGTTCCTAACTCGAGTTAGGAACTGTTGGCCTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173486.1-519s1c1
Sequence:CCGGCAGGAGCTGTTAGAGCCTAAACTCGAGTTTAGGCTCTAACAGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142040    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173486.1-1445s1c1
Sequence:CCGGGCACCAACTCAACCTTTGCTTCTCGAGAAGCAAAGGTTGAGTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173486.1-589s1c1
Sequence:CCGGGCACTCTTGAGAGCAGAGAAACTCGAGTTTCTCTGCTCTCAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks