EMAIL THIS PAGE TO A FRIEND

C2orf74

chromosome 2 open reading frame 74

36 Gene Product Result for
Species: Human C2orf74(339804)
UniProtKB ID: A8MZ97, C9JP62
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001143959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001143959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001143959 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221261 MISSION® esiRNA esiRNA targeting human C2orf74 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001725951 Rosetta Predictions human pricing
XM_291016 Rosetta Predictions human pricing
XM_941655 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00471015 predicted 242
2 SASI_Hs02_00471016 predicted 352
3 SASI_Hs02_00471017 predicted 314
4 SASI_Hs02_00471018 predicted 425
5 SASI_Hs02_00471019 predicted 437
6 SASI_Hs02_00471020 predicted 356
7 SASI_Hs02_00471021 predicted 345
8 SASI_Hs02_00471022 predicted 254
9 SASI_Hs02_00471023 predicted 444
10 SASI_Hs02_00471024 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291016 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269059 predicted 243
2 SASI_Hs01_00269060 predicted 350
3 SASI_Hs02_00479041 predicted 315
4 SASI_Hs01_00269061 predicted 430
5 SASI_Hs01_00269062 predicted 444
6 SASI_Hs01_00269063 predicted 358
7 SASI_Hs01_00269064 predicted 354
8 SASI_Hs01_00269066 predicted 255
9 SASI_Hs01_00269067 predicted 449
10 SASI_Hs01_00269068 predicted 439
11 SASI_Hs01_00269065 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485011 predicted 240
2 SASI_Hs02_00485012 predicted 344
3 SASI_Hs02_00485013 predicted 319
4 SASI_Hs02_00485014 predicted 431
5 SASI_Hs02_00485015 predicted 437
6 SASI_Hs02_00485016 predicted 356
7 SASI_Hs02_00485017 predicted 347
8 SASI_Hs02_00485018 predicted 255
9 SASI_Hs02_00485019 predicted 446
10 SASI_Hs02_00485020 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001143959
VALIDATED
C2orf74 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 74
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001143959.1-634s21c1
Sequence:CCGGTTGAAAGACTGAGGGTACAAACTCGAGTTTGTACCCTCAGTCTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001143959.1-539s21c1
Sequence:CCGGACCCTACACCTCGAAGCTATACTCGAGTATAGCTTCGAGGTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143959.1-218s21c1
Sequence:CCGGAGGACCATGAAAGGATCTTAACTCGAGTTAAGATCCTTTCATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143959.1-75s21c1
Sequence:CCGGCATTTGCATCCTCCTCTTATTCTCGAGAATAAGAGGAGGATGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143959.1-31s21c1
Sequence:CCGGGAAACCACAGCAATCACTTTCCTCGAGGAAAGTGATTGCTGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001143959
VALIDATED
C2orf74 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 74
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001143959.1-634s21c1
Sequence:CCGGTTGAAAGACTGAGGGTACAAACTCGAGTTTGTACCCTCAGTCTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001143959.1-539s21c1
Sequence:CCGGACCCTACACCTCGAAGCTATACTCGAGTATAGCTTCGAGGTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143959.1-218s21c1
Sequence:CCGGAGGACCATGAAAGGATCTTAACTCGAGTTAAGATCCTTTCATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143959.1-75s21c1
Sequence:CCGGCATTTGCATCCTCCTCTTATTCTCGAGAATAAGAGGAGGATGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143959.1-31s21c1
Sequence:CCGGGAAACCACAGCAATCACTTTCCTCGAGGAAAGTGATTGCTGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001143959
VALIDATED
C2orf74 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 74
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001143959.1-634s21c1
Sequence:CCGGTTGAAAGACTGAGGGTACAAACTCGAGTTTGTACCCTCAGTCTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001143959.1-539s21c1
Sequence:CCGGACCCTACACCTCGAAGCTATACTCGAGTATAGCTTCGAGGTGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143959.1-218s21c1
Sequence:CCGGAGGACCATGAAAGGATCTTAACTCGAGTTAAGATCCTTTCATGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143959.1-75s21c1
Sequence:CCGGCATTTGCATCCTCCTCTTATTCTCGAGAATAAGAGGAGGATGCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001143959.1-31s21c1
Sequence:CCGGGAAACCACAGCAATCACTTTCCTCGAGGAAAGTGATTGCTGTGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks