EMAIL THIS PAGE TO A FRIEND

C2orf76

chromosome 2 open reading frame 76

23 Gene Product Result for
Synonyms: AIM29
Species: Human C2orf76(130355)
UniProtKB ID: Q3KRA6, B7ZLS8, Q4VC35
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017927 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065811 MISSION® esiRNA esiRNA human C2orf76 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017927 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048150 predicted 625
2 SASI_Hs01_00048152 predicted 632
3 SASI_Hs01_00048155 predicted 638
4 SASI_Hs01_00048157 predicted 725
5 SASI_Hs02_00306809 predicted 701
6 SASI_Hs01_00048158 predicted 613
7 SASI_Hs01_00048159 predicted 573
8 SASI_Hs02_00306810 predicted 635
9 SASI_Hs02_00306811 predicted 649
10 SASI_Hs02_00306812 predicted 622
11 SASI_Hs01_00048151 predicted 715
12 SASI_Hs01_00048153 predicted 734
13 SASI_Hs01_00048154 predicted 832
14 SASI_Hs01_00048156 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017927
VALIDATED
C2orf76 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 76
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001017927.1-821s1c1
Sequence:CCGGGAATCGCCAGTGAAACTGAAACTCGAGTTTCAGTTTCACTGGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001017927.1-1002s1c1
Sequence:CCGGCAGGCTATACTCTTTGAGCTACTCGAGTAGCTCAAAGAGTATAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017927.1-561s1c1
Sequence:CCGGCCGTTCCTTTGAACATCGCAACTCGAGTTGCGATGTTCAAAGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001017927.1-775s1c1
Sequence:CCGGGACGAAAGACTCCTGCTGAAACTCGAGTTTCAGCAGGAGTCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001017927.1-601s1c1
Sequence:CCGGCACGGAGTGAATTTGGACCAACTCGAGTTGGTCCAAATTCACTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001017927.1-579s1c1
Sequence:CCGGCAATTTCAAACCTGTAGTGTACTCGAGTACACTACAGGTTTGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017927.1-870s1c1
Sequence:CCGGGAACTACAAAGCTAATCCCATCTCGAGATGGGATTAGCTTTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001017927.1-928s1c1
Sequence:CCGGGCATACCTGTATTAAGCTCTTCTCGAGAAGAGCTTAATACAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001017927.1-1037s1c1
Sequence:CCGGCTTTCTCTTCAGGTCTTTCTTCTCGAGAAGAAAGACCTGAAGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001017927.1-827s1c1
Sequence:CCGGCCAGTGAAACTGAAATTGCATCTCGAGATGCAATTTCAGTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017927
VALIDATED
C2orf76 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 76
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001017927.1-821s1c1
Sequence:CCGGGAATCGCCAGTGAAACTGAAACTCGAGTTTCAGTTTCACTGGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001017927.1-1002s1c1
Sequence:CCGGCAGGCTATACTCTTTGAGCTACTCGAGTAGCTCAAAGAGTATAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017927.1-561s1c1
Sequence:CCGGCCGTTCCTTTGAACATCGCAACTCGAGTTGCGATGTTCAAAGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001017927.1-775s1c1
Sequence:CCGGGACGAAAGACTCCTGCTGAAACTCGAGTTTCAGCAGGAGTCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001017927.1-601s1c1
Sequence:CCGGCACGGAGTGAATTTGGACCAACTCGAGTTGGTCCAAATTCACTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001017927.1-579s1c1
Sequence:CCGGCAATTTCAAACCTGTAGTGTACTCGAGTACACTACAGGTTTGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017927.1-870s1c1
Sequence:CCGGGAACTACAAAGCTAATCCCATCTCGAGATGGGATTAGCTTTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001017927.1-928s1c1
Sequence:CCGGGCATACCTGTATTAAGCTCTTCTCGAGAAGAGCTTAATACAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001017927.1-1037s1c1
Sequence:CCGGCTTTCTCTTCAGGTCTTTCTTCTCGAGAAGAAAGACCTGAAGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001017927.1-827s1c1
Sequence:CCGGCCAGTGAAACTGAAATTGCATCTCGAGATGCAATTTCAGTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017927
VALIDATED
C2orf76 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 76
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001017927.1-821s1c1
Sequence:CCGGGAATCGCCAGTGAAACTGAAACTCGAGTTTCAGTTTCACTGGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001017927.1-1002s1c1
Sequence:CCGGCAGGCTATACTCTTTGAGCTACTCGAGTAGCTCAAAGAGTATAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017927.1-561s1c1
Sequence:CCGGCCGTTCCTTTGAACATCGCAACTCGAGTTGCGATGTTCAAAGGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001017927.1-775s1c1
Sequence:CCGGGACGAAAGACTCCTGCTGAAACTCGAGTTTCAGCAGGAGTCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001017927.1-601s1c1
Sequence:CCGGCACGGAGTGAATTTGGACCAACTCGAGTTGGTCCAAATTCACTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001017927.1-579s1c1
Sequence:CCGGCAATTTCAAACCTGTAGTGTACTCGAGTACACTACAGGTTTGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017927.1-870s1c1
Sequence:CCGGGAACTACAAAGCTAATCCCATCTCGAGATGGGATTAGCTTTGTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001017927.1-928s1c1
Sequence:CCGGGCATACCTGTATTAAGCTCTTCTCGAGAAGAGCTTAATACAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144146    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001017927.1-1037s1c1
Sequence:CCGGCTTTCTCTTCAGGTCTTTCTTCTCGAGAAGAAAGACCTGAAGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001017927.1-827s1c1
Sequence:CCGGCCAGTGAAACTGAAATTGCATCTCGAGATGCAATTTCAGTTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks