EMAIL THIS PAGE TO A FRIEND

C2orf78

chromosome 2 open reading frame 78

29 Gene Product Result for
Synonyms: COG5373 hCG1989538
Species: Human C2orf78(388960)
UniProtKB ID: A6NCI8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080474 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026241 MISSION® esiRNA esiRNA human C2orf78 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080474 Rosetta Predictions human pricing
XM_371500 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315186 predicted 898
2 SASI_Hs02_00315187 predicted 1924
3 SASI_Hs02_00315188 predicted 949
4 SASI_Hs02_00315189 predicted 1492
5 SASI_Hs02_00315190 predicted 678
6 SASI_Hs02_00315191 predicted 2784
7 SASI_Hs02_00315192 predicted 1076
8 SASI_Hs02_00315193 predicted 784
9 SASI_Hs02_00315194 predicted 1273
10 SASI_Hs02_00315195 predicted 801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257312 predicted 2159
2 SASI_Hs01_00257313 predicted 1869
3 SASI_Hs01_00257314 predicted 1842
4 SASI_Hs01_00257315 predicted 2000
5 SASI_Hs01_00257316 predicted 1911
6 SASI_Hs01_00257317 predicted 2123
7 SASI_Hs01_00257318 predicted 2117
8 SASI_Hs01_00257319 predicted 2186
9 SASI_Hs01_00257320 predicted 2754
10 SASI_Hs01_00257321 predicted 1981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080474
C2orf78 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 78
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080474.1-739s21c1
Sequence:CCGGGATAGGAAGCCAGGTCTATTACTCGAGTAATAGACCTGGCTTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080474.1-2375s21c1
Sequence:CCGGGCTCGACCTGATTCTACTAACCTCGAGGTTAGTAGAATCAGGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080474.1-598s21c1
Sequence:CCGGGTCTATGACAGCCCAGTATTACTCGAGTAATACTGGGCTGTCATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080474.1-406s21c1
Sequence:CCGGTGCCTACCTTTACCAACATTCCTCGAGGAATGTTGGTAAAGGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080474
C2orf78 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 78
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080474.1-739s21c1
Sequence:CCGGGATAGGAAGCCAGGTCTATTACTCGAGTAATAGACCTGGCTTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080474.1-2375s21c1
Sequence:CCGGGCTCGACCTGATTCTACTAACCTCGAGGTTAGTAGAATCAGGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080474.1-598s21c1
Sequence:CCGGGTCTATGACAGCCCAGTATTACTCGAGTAATACTGGGCTGTCATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080474.1-406s21c1
Sequence:CCGGTGCCTACCTTTACCAACATTCCTCGAGGAATGTTGGTAAAGGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080474
C2orf78 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 78
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080474.1-739s21c1
Sequence:CCGGGATAGGAAGCCAGGTCTATTACTCGAGTAATAGACCTGGCTTCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080474.1-2375s21c1
Sequence:CCGGGCTCGACCTGATTCTACTAACCTCGAGGTTAGTAGAATCAGGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080474.1-598s21c1
Sequence:CCGGGTCTATGACAGCCCAGTATTACTCGAGTAATACTGGGCTGTCATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080474.1-406s21c1
Sequence:CCGGTGCCTACCTTTACCAACATTCCTCGAGGAATGTTGGTAAAGGTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks