EMAIL THIS PAGE TO A FRIEND

C2orf80

chromosome 2 open reading frame 80

45 Gene Product Result for
Species: Human C2orf80(389073)
UniProtKB ID: Q0P641, A6NKZ3
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302873 ANTI-C2ORF80 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099334 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143051 MISSION® esiRNA esiRNA human C2orf80 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099334 Rosetta Predictions human pricing
XM_371592 Rosetta Predictions human pricing
XM_934661 Rosetta Predictions human pricing
XM_934662 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320469 predicted 685
2 SASI_Hs02_00320470 predicted 217
3 SASI_Hs02_00320471 predicted 299
4 SASI_Hs02_00320472 predicted 611
5 SASI_Hs02_00320473 predicted 602
6 SASI_Hs02_00320474 predicted 266
7 SASI_Hs02_00320475 predicted 617
8 SASI_Hs02_00320476 predicted 624
9 SASI_Hs02_00320477 predicted 415
10 SASI_Hs02_00320478 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277254 predicted 418
2 SASI_Hs01_00277255 predicted 732
3 SASI_Hs01_00277256 predicted 260
4 SASI_Hs01_00277257 predicted 649
5 SASI_Hs01_00277258 predicted 645
6 SASI_Hs01_00277259 predicted 299
7 SASI_Hs01_00277260 predicted 663
8 SASI_Hs01_00277261 predicted 754
9 SASI_Hs01_00277262 predicted 618
10 SASI_Hs01_00277263 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299513 predicted 336
2 SASI_Hs01_00299514 predicted 343
3 SASI_Hs01_00299515 predicted 514
4 SASI_Hs01_00299516 predicted 418
5 SASI_Hs01_00299517 predicted 474
6 SASI_Hs01_00299518 predicted 256
7 SASI_Hs01_00299519 predicted 487
8 SASI_Hs01_00299520 predicted 308
9 SASI_Hs01_00299521 predicted 439
10 SASI_Hs01_00299522 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261095 predicted 301
2 SASI_Hs01_00261096 predicted 319
3 SASI_Hs01_00261097 predicted 483
4 SASI_Hs01_00261098 predicted 451
5 SASI_Hs01_00261099 predicted 237
6 SASI_Hs01_00261100 predicted 276
7 SASI_Hs01_00261101 predicted 408
8 SASI_Hs01_00261102 predicted 591
9 SASI_Hs01_00261103 predicted 426
10 SASI_Hs01_00261104 predicted 290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099334
C2orf80 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 80
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099334.2-476s21c1
Sequence:CCGGCCGATTGAGGAAGTCTTTAAACTCGAGTTTAAAGACTTCCTCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099334.2-420s21c1
Sequence:CCGGGAGAACGAGAAGCTATGATTTCTCGAGAAATCATAGCTTCTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099334.2-389s21c1
Sequence:CCGGCTCCATGGCAGACCCATATATCTCGAGATATATGGGTCTGCCATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099334.2-803s21c1
Sequence:CCGGGACGAGAAGCATCATCTTAAACTCGAGTTTAAGATGATGCTTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099334.2-445s21c1
Sequence:CCGGATCTTATGCTGGAATCTTAATCTCGAGATTAAGATTCCAGCATAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099334
C2orf80 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 80
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099334.2-476s21c1
Sequence:CCGGCCGATTGAGGAAGTCTTTAAACTCGAGTTTAAAGACTTCCTCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099334.2-420s21c1
Sequence:CCGGGAGAACGAGAAGCTATGATTTCTCGAGAAATCATAGCTTCTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099334.2-389s21c1
Sequence:CCGGCTCCATGGCAGACCCATATATCTCGAGATATATGGGTCTGCCATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099334.2-803s21c1
Sequence:CCGGGACGAGAAGCATCATCTTAAACTCGAGTTTAAGATGATGCTTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099334.2-445s21c1
Sequence:CCGGATCTTATGCTGGAATCTTAATCTCGAGATTAAGATTCCAGCATAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099334
C2orf80 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 80
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099334.2-476s21c1
Sequence:CCGGCCGATTGAGGAAGTCTTTAAACTCGAGTTTAAAGACTTCCTCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099334.2-420s21c1
Sequence:CCGGGAGAACGAGAAGCTATGATTTCTCGAGAAATCATAGCTTCTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099334.2-389s21c1
Sequence:CCGGCTCCATGGCAGACCCATATATCTCGAGATATATGGGTCTGCCATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268513    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099334.2-803s21c1
Sequence:CCGGGACGAGAAGCATCATCTTAAACTCGAGTTTAAGATGATGCTTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099334.2-445s21c1
Sequence:CCGGATCTTATGCTGGAATCTTAATCTCGAGATTAAGATTCCAGCATAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks