EMAIL THIS PAGE TO A FRIEND

C2orf81

chromosome 2 open reading frame 81

42 Gene Product Result for
Synonyms: hCG40743
Species: Human C2orf81(388963)
UniProtKB ID: A6NN90
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371503 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001726549 Rosetta Predictions human pricing
XM_371503 Rosetta Predictions human pricing
XM_942034 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00474954 predicted 2239
2 SASI_Hs02_00474955 predicted 2431
3 SASI_Hs02_00474956 predicted 2200
4 SASI_Hs02_00474957 predicted 2401
5 SASI_Hs02_00474958 predicted 2374
6 SASI_Hs02_00474959 predicted 2176
7 SASI_Hs02_00474960 predicted 624
8 SASI_Hs02_00474961 predicted 2431
9 SASI_Hs02_00474962 predicted 406
10 SASI_Hs02_00474963 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479326 predicted 2240
2 SASI_Hs02_00479327 predicted 2435
3 SASI_Hs02_00479328 predicted 2200
4 SASI_Hs01_00259821 predicted 2400
5 SASI_Hs01_00259822 predicted 2376
6 SASI_Hs02_00479329 predicted 2184
7 SASI_Hs01_00259824 predicted 624
8 SASI_Hs01_00259825 predicted 2435
9 SASI_Hs02_00479330 predicted 403
10 SASI_Hs02_00479331 predicted 983
11 SASI_Hs01_00259816 predicted 1976
12 SASI_Hs01_00259817 predicted 2075
13 SASI_Hs01_00259818 predicted 2141
14 SASI_Hs01_00259819 predicted 2291
15 SASI_Hs01_00259820 predicted 2335
16 SASI_Hs01_00259823 predicted 2290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_942034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485223 predicted 2238
2 SASI_Hs02_00485224 predicted 2435
3 SASI_Hs02_00485225 predicted 2200
4 SASI_Hs02_00485226 predicted 2404
5 SASI_Hs02_00485227 predicted 2375
6 SASI_Hs02_00485228 predicted 2175
7 SASI_Hs02_00485229 predicted 625
8 SASI_Hs02_00485230 predicted 2432
9 SASI_Hs02_00485231 predicted 407
10 SASI_Hs02_00485232 predicted 982
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371503
C2orf81 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 81
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-1771s1c1
Sequence:CCGGCCCACTTTAAATTTAGGCCTACTCGAGTAGGCCTAAATTTAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-2416s1c1
Sequence:CCGGCGGAGGCTTCTACAGGAGAATCTCGAGATTCTCCTGTAGAAGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-2511s1c1
Sequence:CCGGCTCACCTTTGTCACTAACTATCTCGAGATAGTTAGTGACAAAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-654s1c1
Sequence:CCGGGCAGTGCATTCCATTCACCATCTCGAGATGGTGAATGGAATGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-1304s1c1
Sequence:CCGGCGTTGGAAGACCTCTACTGTTCTCGAGAACAGTAGAGGTCTTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371503
C2orf81 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 81
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-1771s1c1
Sequence:CCGGCCCACTTTAAATTTAGGCCTACTCGAGTAGGCCTAAATTTAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-2416s1c1
Sequence:CCGGCGGAGGCTTCTACAGGAGAATCTCGAGATTCTCCTGTAGAAGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-2511s1c1
Sequence:CCGGCTCACCTTTGTCACTAACTATCTCGAGATAGTTAGTGACAAAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-654s1c1
Sequence:CCGGGCAGTGCATTCCATTCACCATCTCGAGATGGTGAATGGAATGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-1304s1c1
Sequence:CCGGCGTTGGAAGACCTCTACTGTTCTCGAGAACAGTAGAGGTCTTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371503
C2orf81 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 81
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-1771s1c1
Sequence:CCGGCCCACTTTAAATTTAGGCCTACTCGAGTAGGCCTAAATTTAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-2416s1c1
Sequence:CCGGCGGAGGCTTCTACAGGAGAATCTCGAGATTCTCCTGTAGAAGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-2511s1c1
Sequence:CCGGCTCACCTTTGTCACTAACTATCTCGAGATAGTTAGTGACAAAGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-654s1c1
Sequence:CCGGGCAGTGCATTCCATTCACCATCTCGAGATGGTGAATGGAATGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371503.1-1304s1c1
Sequence:CCGGCGTTGGAAGACCTCTACTGTTCTCGAGAACAGTAGAGGTCTTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks