EMAIL THIS PAGE TO A FRIEND

C2orf83

chromosome 2 open reading frame 83

19 Gene Product Result for
Species: Human C2orf83(56918)
UniProtKB ID: Q53S99, A2RRG6, B8ZZI8, Q9NPW4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020161 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020161 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059128 predicted 575
2 SASI_Hs01_00059129 predicted 499
3 SASI_Hs01_00059130 predicted 569
4 SASI_Hs01_00059131 predicted 551
5 SASI_Hs01_00059132 predicted 151
6 SASI_Hs01_00059133 predicted 632
7 SASI_Hs01_00059134 predicted 98
8 SASI_Hs01_00059135 predicted 382
9 SASI_Hs01_00059136 predicted 312
10 SASI_Hs02_00353062 predicted 603
11 SASI_Hs01_00059137 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020161
C2orf83 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 83
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020161.2-286s1c1
Sequence:CCGGCCATCTGAGAAACTAGAGCCTCTCGAGAGGCTCTAGTTTCTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020161.2-262s1c1
Sequence:CCGGCCCAGCTTCCAGAACTTATTACTCGAGTAATAAGTTCTGGAAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020161.2-138s1c1
Sequence:CCGGGATTCAACCCATCGTGACGATCTCGAGATCGTCACGATGGGTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020161.2-318s1c1
Sequence:CCGGGATGAGGAAACTTACCGTACACTCGAGTGTACGGTAAGTTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020161.2-563s1c1
Sequence:CCGGCCATGGCAAATACCACTCTTTCTCGAGAAAGAGTGGTATTTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020161.3-628s21c1
Sequence:CCGGGAACAAGAAGCCACAAGATTCCTCGAGGAATCTTGTGGCTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020161.3-741s21c1
Sequence:CCGGTATAATTCTTTGTGCACAATGCTCGAGCATTGTGCACAAAGAATTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020161.3-832s21c1
Sequence:CCGGGCCTTTATATCTAGGAGTTTCCTCGAGGAAACTCCTAGATATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020161
C2orf83 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 83
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020161.2-286s1c1
Sequence:CCGGCCATCTGAGAAACTAGAGCCTCTCGAGAGGCTCTAGTTTCTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020161.2-262s1c1
Sequence:CCGGCCCAGCTTCCAGAACTTATTACTCGAGTAATAAGTTCTGGAAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020161.2-138s1c1
Sequence:CCGGGATTCAACCCATCGTGACGATCTCGAGATCGTCACGATGGGTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020161.2-318s1c1
Sequence:CCGGGATGAGGAAACTTACCGTACACTCGAGTGTACGGTAAGTTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020161.2-563s1c1
Sequence:CCGGCCATGGCAAATACCACTCTTTCTCGAGAAAGAGTGGTATTTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020161.3-628s21c1
Sequence:CCGGGAACAAGAAGCCACAAGATTCCTCGAGGAATCTTGTGGCTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020161.3-741s21c1
Sequence:CCGGTATAATTCTTTGTGCACAATGCTCGAGCATTGTGCACAAAGAATTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020161.3-832s21c1
Sequence:CCGGGCCTTTATATCTAGGAGTTTCCTCGAGGAAACTCCTAGATATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020161
C2orf83 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 83
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020161.2-286s1c1
Sequence:CCGGCCATCTGAGAAACTAGAGCCTCTCGAGAGGCTCTAGTTTCTCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020161.2-262s1c1
Sequence:CCGGCCCAGCTTCCAGAACTTATTACTCGAGTAATAAGTTCTGGAAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020161.2-138s1c1
Sequence:CCGGGATTCAACCCATCGTGACGATCTCGAGATCGTCACGATGGGTTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020161.2-318s1c1
Sequence:CCGGGATGAGGAAACTTACCGTACACTCGAGTGTACGGTAAGTTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020161.2-563s1c1
Sequence:CCGGCCATGGCAAATACCACTCTTTCTCGAGAAAGAGTGGTATTTGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020161.3-628s21c1
Sequence:CCGGGAACAAGAAGCCACAAGATTCCTCGAGGAATCTTGTGGCTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020161.3-741s21c1
Sequence:CCGGTATAATTCTTTGTGCACAATGCTCGAGCATTGTGCACAAAGAATTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020161.3-832s21c1
Sequence:CCGGGCCTTTATATCTAGGAGTTTCCTCGAGGAAACTCCTAGATATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks